Description :
From Genome Similarity Track
Location :
Scaffold_1357:4- 1130
Transcript NameFunction/comments
g16514.t1hypothetical protein

Sequence
1126 bases(100 bases per row)
GGTACACAACGATCTGGGAAATGAGTACATTAAGATTCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCCG
GGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCA
TCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGA
GGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCG
ATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACGCGTCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACTATCA
TGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGTGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCA
GTTTCCTATCCAGACTGCTTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCAC
GGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCATTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGG
CGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTGGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCAGTTTGCATAGCGG
TAATTGTTGAGAGTCGCCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAG
TGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTG
GTTTGAAGTCCGTGTGCGAAGCACGC