Description :
From Genome Similarity Track
Location :
Scaffold_4495:4- 1094
Sequence
1090 bases(100 bases per row)
AAATGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCTACGCTGTTCGGCGGACCCGAGTTCCATGGGAGCTGGTCCGCTGGGGCTTGTTCGACCGGGA
GCCGACAAGGAGCTTCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGACTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCGAGGGTGC
TTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGCTGTGTTCATTGAGTGGGTTTCCCACTAG
GGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGCTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTC
GCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGGAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCAC
GACCGCTAAGGCTGGAGAGTGTAAAAGCAACACGCAGTTACTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAG
GTTCTCGCCTTCCTTCCCTTCATACGGCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGC
ACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGACACCACCAGGCTCTGCAGGGCCTTCATCC
CGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCAAATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGAAGGTTCAGGTAG
TCTACCCGCAATGGCGTGGATTGACTACTAGTTCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCAAGAGGAAGTTATCGTCCGAGAGTATACAAA
CTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTTATTAAAGAGAGCGAAGTCCCAAATAAGGTAGATTGTAAACTAAGTATATTTATA