Description :
From Genome Similarity Track
Location :
Scaffold_4153:4- 1079
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_4153-fgenesh-gene-0.0Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1075 bases(100 bases per row)
CTGTTCGTGACCCGTCACCGCTACGTGAATGTGCCACCGACCGAGAGTTCGGTCGGTCTCTTCATCAAGATCGTCGTCAAGCACGCGAAGAAGAGCTTCC
GCGCCAAGATGCTCGTGCTCGGGACGGTGCTCTACATTGCGGCGTTTCTCATGAACATCCTTGCATCGTTCTTCGCGGACCACGGCGAGACCGGTCACCA
CATCTCGTACGGCTGCGGCGTGTGCATCATCATTGCGACGGTCCTCTGGGTGTACTTTGGTCGCGACTCGTCGTTCATGAACAGCGCCAAGGTCACTGAA
GGCGGTGCCTACGAGGAAGAGCTCATCAACGGCGTCAAGCAAGTGATCCGCATTCTCCCATTCAACGCGTTCAACGTCTTTTGGTGGGTCTGCCAGAACC
AGCGCGGCAACAACCAGTCGATCATCCAGCAGACCGACGTGCGTCTGGGCAGCGGTCCAGACTCGAGCCAGATCCCAGGTCCAACCGTGCAGATGTTCAA
CCCAATCGGTGTGCTTTTGTTTGTGCCCCTTACTGAACGAGTGATCTACCCGCTCTACGAGAAGTACGCGGGTAAGCCAGCGTCCCGCTACGGGAAGGTG
CTCACGGGCTATTGTATTGCCGCATTCGCGATGTTCTGGACGGGTTCGTACGAGATCATTCGTCGTGGAGCTGGTCCAATCACCTACACCGGCGCGGACG
GTCTCAGCCACTTCATCTACAACGACGACGGCAAGCAAGTAATGAACGACATCCCGTGGTGGACCGGTCTCCCGCACTACCTTTTGGTCGCGCTCGCCGG
TGTGTTCATCGTGATCCCGTCGTACGACATCTGCTACTCCGAGGTACCACAGAGCATGCGCGGCACATCGATCGCGCTCGGCTTCTTCGTCAACTCAATG
GGCAGCACGCTGCTCTCGATCATCGTGTTGCTCTTCGGCAAGTTCATCACGCCGAACCTGAACAACGGCCACATGGAGTATATGCACTTCACGATCGGCG
GCATCATGCTGGTGAACATCGCGGTGTTTGTCTACGTGATGAACAAGATGAAGCTCGGCATGCTGCCTCCAGTCG