Description :
From Genome Similarity Track
Location :
Scaffold_3014:4- 1007
Sequence
1003 bases(100 bases per row)
ACACCGCGAGCGGTATCGTTGAAGCTCCATGTGAGCAACTACGTAGGAAAAAGAGGGCGACCCCCTTCTCCGTTCGCTAGTCGAAGTCGACACAGCCATT
ATGGCTCGACGTATCGTTGGCTCGTTGTCGAAGGTTGCGTTCGCCATACCGTGTCTTGGCGGACGAGCAAGGAGTTGGACGTGCGGACGCTGATTCGCAG
ATCCTAcgtgcttcagcacgtacGAGGCATTCAAGGAGGAACTCAGACAAGCGTNAAAGGACACGGTACTTGGTCTCGAACATCGTGACCAACTCGATAG
ACGAGGCGACCAAGGTCGTCAATTTCATGAAGGGCTTGAAGGATGGGCCAGTCAAGAAAAATCTACCCGAGTACTCTCGAAGCTGCAATCACGATCACAA
TGAAAGAAGCGTTTAGCCTGCGGCAGGCTCAACTGCATGTGAACGTGTCAAGGATGCCACGTCCGGAGATAAGGACGGGAGGTCCAGAGCCAATGGACCT
CTCGAACGCGATGGCTGGGAATAacccaccacgtcgtggtgctgacgTACGATGCTTCCGTTGCGGACGCATCGGTCATTTTGCGTGtgagtgcacagca
cctgTGCACGGGCAGAGAAGCCAACGTGGTGATGCAGGGTATTGTCGCGATCAATATAAAAACGCGCGGAACCTGTAGGCGCGGAACCAGTAGCCCTACT
GGTGAAGCAGTCACGCGTGTCGACATTGGATACGCGTCAATGAGGACTGCGGCCACCGCCGAGAGACATTCTCTCTGCAACAAGCGAGATGACAAGCCAA
ACCTTGCCATACTGGACGtgacttcgaggaggtgcaaaCGTCTCGAAGCGAATTagaagtacgactggcaACAGGTGCTGTCGTGAAGACCGAGAAGCGT
CACGTATGCGTACACTTCTCGTATCGACAAAAGTGAAAAGCTTATCGTCTTGGATTTAGACGCCACGttcaacttggtgctgggcatgccGTGGCTTGCA
CGg