Description :
From Genome Similarity Track
Location :
Scaffold_1119:3999- 10661
Transcript NameFunction/comments
Phyag_g9564hypothetical protein PHYSODRAFT_545950

Sequence
6662 bases(100 bases per row)
GGCCACGGCGAGATggaccgccgccgccgcgccaGCTCCAACTACTTCGAACTGGACGCGGATCGGCGGCGCAACAAGTCGGAGCGGTCGGCGCGCTTCA
GCTCCCGCCTCAACACGATGGACGTGACGCCTGCGAGCGCAAAGGGCGTCGCGCAAGACGACGAGGCCGCGATCGACTACTGCTGCGAGTTCCTCAAGGC
CAAGTTCGGCTTCCAAGAAGGCTCGGCCAGCAATCAGCGCGaacacgtgctgctgcttttggcgAACGGCAAGGCGCGCTGCTTGCCCAACGACGCAGCT
GACGCGCACCTGGTGCAGCTGgcgaacaagctgctgtccaaCTACCGGTCGTGGTGCAAATTCATCCACGCGCAAACCGTGACTTTTTCCGGCAGCGGCA
TCCCGCACTCTACGCCTTCGGGGAATTTGCACATGGACGTCATGCTGTACTTCCTCATCTGGGGAGAAGCCGCGAACGTGCGCCACATGCCAGAATGCGT
ATGCTACTTGTTCCACCAGATGCTCACCATGGTGAACCAAGACCCCGAAGggcgcgagcagcagcaagaaggctgGTATTTACACCAAGTGATCCGCCCA
ATTTGGCGCGAAGCCAGCAACATGAAGCGCAAAAACGCGCTCAACAAGCCTCTGGAGCACGTGAAAATCCGCAATtacgacgacatcaacgAGTACTTTT
GGAAACAGCACTGCCTCAGCATCCCCGTCACGAAAGTCGGGGAGGAGCTGACGCAAAACCACGGCAAAACGTTCTACGAGCACCGCAGTTTACTGACCAT
GGTGCTCAACTACTACCGCATCTTCCAGTTCAACATGATGTTTCTGGTGCTGCTAACCGTTTTGGCATTTGCGGTCACGATTTCGCCAGATGGCGGCAAA
AGTGGCTGGGTGCAATTCGGCCGGATCGGAGATGTGGTGGACCCGTACACAACGCGGGATTTGAAGTTGGCGGTCGTTGCGATCCCCTTCAGTTTGAGTC
TCATGGCCTTTTTGAAGTGTGTGATGGAGGTGTGTCACGGCTGGCACTTGTTGATCTCCAAAGAGAGCTCGGCCACAAGTTCGCGATCTTTCTCGTACGG
GTCGGCGTTAGCCACTCGCATCATTTGGAATGGCGGCTTTGCGGTCTTATTTGGCATTATGATTTACGTGCCGCTAAACGAGGACAAAGACACGACGCTA
CTGGATAACCTTTATCCACTTTGCGGCGCGTATATCCTGCCGGGCCTTTTGGTGTTGCTAACGCAAGCTTTTGCGCCACAAGTCATTAGCGGCACTTTTG
CGGCCAAATTTGTGCGCGAAGGAGAGAGTTGCTATGTGGGCCAAGATATGACCCCACCCTTCTCGTACCAAGTCAAGTACATTGTGTTCTGGATCTTATT
GTGGATCGTGGAAGCGATTGCGTCATACTTTATCCTCGTGCGGCCGTTGATGCTGCCGACGTTGAGTATTTACGCCATGACGCTGGATTACCAGAATTCC
TTGGTGTCGTTCCACAATATTGGAATTATCATTGCACTCTGGCTGCCGGTGGTGTTTATCTTCAATTACGCCACACAAATCTACTTTACCATTTTTCAGG
CACTACTGGGAGGATTCCAGGGTATTCTCATGAAGACGGGCGAGATTCGTGGTGCTAAAGAGATGACCAAGGCTTTCCGTGTTGCACCTCAATTGTTCGA
CcagaaggtggtgacgcTTCTTGCGCGGTCGAGTGATGCTTCTGCTACTGGAACGGATTCGACCCGTGCCAGTGCTTTGGCTGCAGCTTACGAGTCGCAG
ATGATGCTGCGTTTTGTGGTGGTGTGGAATGAGATCGTCAACTCGTTTCGTGAAGGAGATCTTTTGGACGATAAGGAGGCTGCTATTCTTCAGTACGATA
TTCGCAGCACTGGTGAAGTATTCGAGCCTGTGTTCCTGTCGGCTGGTAAGTTGACGGAGGCTATGGGTTTGGCTATCAAGACTGCTAAGGACGGCAAGGG
AGAGTCGCAGCTCCGTGTGACACTCGTTGAGAATGACTGTCTGTCGGCTATCCGTTCGTTCTTTACGGCCAGTATGTACGTGGTGAGTGCCTTGTTCGGC
AACGATGACGCGGATGTGGTCGATGGTTTCCGCATGCTTGAGGAGATCGCCTCTAGTGGCGGATTCCTGAAGTCGTTTAATGTCCGTGAGCTTGCGAGCC
tgcgcgttgctgctgttgatatTCTGGAAGAGATTCTGGACCTTCCGGACCCGGATTCGCAGTCCCAGCACATCCCGAACGCGCGTGTTCACTCGATGGG
TGTGATTCGCAACTTTGtctcgaagatggaggcgttTTTGAATGGTGTGCAGTCCTTCTGCATTGACCCTGCTTTGCAGCGCAAGTTCGGCAACTCGAAG
TTCTGCTCAAGCGCCAATGGGTACATGTTTGCTTCGCGTGGACTTGTCAACCTGTTCTGCAGTGACACGGCTATGGGTGCTGCTACGCGTgcgtgtttgc
tgctgtctttggacCGATCGGAGGCTATGCCACGTACTACGGAGgcgcagcgtcgtcttggtttTTTCATGAAGTCACTTGTGATGGACATTCCCCAGCT
GCGTTCCATCAAGGAAATGCGCAGTTTCTCGGTTGTGACCCCGTTCTACGCCGAGACGGTGCTGTTCTCGCTGAAGGACCTGAATGACCCTCTTGTGAAC
CACCcgatcttccagcaggtCGAGGAGGATGGCAAGAACCTGACGATTCTGAAGTACCTGACGAAGATTCACCAGGAGGAATGGGACAACTTCTTGGAGC
GTGTGGATGTGAGCTCCGCCGAGGAGGCCCAGAAGAACCACCCCGAAGAAATCCGTTTGTGGGCATCGTACCGTGGCCAGACTTTGGCGCGTACGGTGCA
GGGTATGATGATGTACGAGGATGCGATCAAGATTCTGCACTGGTTGGAAATTGGCTCCAGCCCAGGCAAGAGCGccgagcagaagcagaaccaGCTACAG
GATATGGTCCGTCTAAAATTTTCGTACATTTGTGCTTGTCAGGTGTACGGAAAGCACCGCGCGGAGGGTAAGGCTCAGGCCGCTGATATTGACTACCTGC
TGCGCGAGTACCCGAACCTGCGTGTGGCTTATGTCGACACGGTGGAGCACGAGGGTGGCGAGAAGTCGTTCGACACTGTGCTGATCAAGAGTGAAGCCGA
TGAGATTGTGGAAGTGTACCGCTACACGCTGCCTGGTGACCCGATTCTGGGTGAAGGTAAACCTGAGAACCAGAACAACGCTGTCCCATTCACGCGTGGT
GAGTTTGTGCAGACCATCGATATGAACCAACAGCACTACTTTGAGGAGTGTTTGAAGATGCCGCAGCTTTTGTGCACGGCAGACCTACACCCGTCGAAGA
AGCCTGTGTCGATCATTGGTATGCGTGAGCACATTTTCACGGGTAACGCCAGTTCGCTGGCTAAGTTCAAGACgtggcaggagctggtgttcGTGACGCT
ATCGCAGCGTGTGCTTGCCGACCCTCTGTACGTTCGTATGCACTACGGTCACCCGGATGTGTTCGATAAGGTCCTGGCTCTTACGCGCGGCGGTGTGTCG
AAGGCCAGTAAGGGTATCAACTTGTCGGAAGATGTGTTCGCAGGTTTCAACTGCACGCTGCGTGGCGGTGTCGTGACGCACGTGGAGTTCATGCAGTGTG
GTAAGGGTCGTGATGTGGCTCTCTCGCAGATCTCGATGTTCGAAGGCAAGCTGGCCAACGGTGCCGGTGAAACTTCGTTGGCGCGTGAGGCTCACCGTAT
GGGCCAGTTCATGGACTTCTTCCGTCTGAACTCGATGTACTACTCGCACACTGGTTTCTACTACGCCACGTGGATGACAATTGTGACGACGttcgtgtac
atgtactgcaaGGTCTACATCGCTCTGTCCGGCGTGCAGACGCAGATTGTGTACAACATGAACACGACGGAGATCATCATGGAGAACTCGTACGACTACG
GTTTTGACAACCGTGTGTATCACGATATGGACTCGGTGTACAACACGCAGTACTACATCCAGGCTGGTTTGTTCCTGTCGCTGCCGCTTATTTGTGTGTA
CTTTGCTGAAATGGGTCTGCGTCGCGGTCTCGTCCAGTTTTTGGAGATGGTGTTCACAGCTGGTCcggcgttcttcatcttccagctCGGTACGACCATg
cacttcttcgacaacaactTGCTTCACGGTGAGGCTCAGTACAAGGCTACGGGACGTGGCTTCAAGATTACGCGTGAgacgttcgtgctgctgtacaaGG
CTTACGCTCCGAGTCACTACCGCAAGGCTATGGAACTTATTGGTCTGTGTTTGGTGTACTTGGCGTTTGGCAAGTTCGACATTTGTGATACGTCTGTTGC
TGGCGAGGTCAACTCGTTTGCATTCGACTATTGTGAGACGTCGCAGAGCTTCGGCGTGCAGACGTTTGCTATTTGGGTTATTGCAGTGGTGTGGTTGGTG
TCTCCGTACATCTTCAACACTGACGGTCTCGACTGGGAAAAGACCAAGGCTGATGTGACGGCATGGGCTAAGTGGATGTACGCCAGCGAGGACTACAAGG
ATGAAGACTCGGTGATGGTTGGTGGGTGGATTGGCTGGTGGAAGGGCGAGCTCAAGCTGTACCACAACACAAAGCCGATTGCTCGTTTCACGGTCATTCT
CCGTGAATGCCGTCACTTTCTACTCATGTGGTACGTGGTGGCGCTCGAGTGGGAGATCCTTACGGTTGGGTTGGTGTTTGGCGCTTCGGTTGTCACGGTC
CTGGCGATGGGCTTGTTCGGTGCTGCCGGCAGCTGCTTCCGCAATGTGAACTCGTCGATTCGCGCGATCATGTACTTgtccgtggtggtgcttgcgCTTA
TtgcgttcttcgtcatcaccaTTGCTATCTCGGACGTCAGCTTCACCAGGACTATCTCTCTGTTCTTCGGCTATATGGCGTCTCTGTATGGCATCAACGA
GATGGCTCGCATGTACAGCTTCGCCAACTCGGGAATCGCCACCGTGGGTatgttccagcagctcgcgttcttcttcgacttcatctttGCGGTGGCTATG
ATCGTCCCGCTGTTGGTGATGTCTGCCATTCCGTTCCTGAACATCATCCAGACTCGTATGATGTACAACAAGGGCTTCTCGGAGGTCGTTTCGGCTTCGT
CTCAGTACGCGTTCTCGCTGGCTGCTTTCATGGGCGTGCTTGGTGGCATTGGCTGCGGCTGGCTGTTCCACCTGTTCACGACGCTTGAAAGCACGGCTGG
CTTCCTGAGTTACGTTACCACATACGATCTGCTTGATGGCAACGTCGGCGATGGCTCGGTCACCTACGCTTTCTACTTCGCTTGCATGGTCGGCACGTTC
GTGGCTGGTTTCCTGAACTACTTCATTGGCCGTCGTCTGTCGATTGTCTTTGGCGGTTTGCTGACGGTGCTGGGTATGCTTGGTGTAAGTTCTGTGCAGT
CAGGCGGCGAGGGTTTCCTGATGCCTGGCATCTGCTTGCTTGGTGGCTCGGTTGGTGTGCTTCTGCCTACTCTGGCTGTGTACATCTACGAGATTTCCAC
TCGTGACATGCGTGGCAAggcccttcttcttcttggcagtGGTTTCATTCTCGGCATTTTGTTCGCCGCTtggttctcctcgtcgtcgaacgagGTGGGC
TGGGTGTGGCAAGTGTTCATTGCGACCATCATCCTGTCAATCATGACGCCGGCAGTGTACATCTTCCCGGAGAGCCCGTACTGGGTGTACATGCGCGAGG
GCCTGGAGTCTTGCGAGCGCTGTCTGGCTGTGCTTCGTCGCAAGGAGGGTGTGTCTGAGGAACTGCGTATGATTCGTGACGAAGAggccggcagcgacga
ctcGAGTGCTAACGGCGGTACCTCTTTCCTCAAGTTCCTGATGGGTCTGTTCCTGATGTTGGTCTCCAGTATCTTCCTCGGTTGCGTGAACATGTACCTG
TCGGACACGTTCCGTAGCATTGAGGACGCGACGTACATGTTCGTGAACTGCACGGGGCTTCAGTTCTTGGGTGCGCTGTtttcgttcttcttcatggacC
GTATCGACCACAAGCGCATCCTGTTCTGCACGTTGTTGCCGATGGCAGCATTGGTGTTTGTTCTGGGTCTGAACGCAAAGTCGGAGTTCGTGACGGGCGA
CAGCGAGTACctgatgctgcagatcgTGGGTCTGTTGCTGTACTTCTTTGCTGGTCTGGGTATCACCTCGGTGCCTTGGGTGTCGTGCGTCGGTCTGTTC
ACCACAAAGCAGCGCGCGGTGTACGTGACCGTCTACTTCATGGTgttcttcctgctgccgGTGTGCGCCACTTACATTCGCTCGAGCGAGTCGATGAGCG
GCGACGAGTACTTCTACCTGTTCGCGCTGACTGGCTGCTGTATTGTGGCGATGGGACTCCTATTCACGGTGGGCACCCTCAAGAACGGCATGGTTTGCAC
TAAGGGCGAGATGGAGGCTGAGCGTGCACGTCTGCGCCGTATCCGAGCATCTCGCCGTAGCGCCCGCACCCCGGGCAGCGCGCGATCAAGAAACTTCAGT
CGCTCGCGCGCAAAGTCACACTCGAACTATCAGATGTACGAGTCGCCTGCAGGCAGCGCACC