Description :
From Genome Similarity Track
Location :
Scaffold_11:39986- 41480
Sequence
1494 bases(100 bases per row)
CATTGCCAACTATGTCAATGAACTAAGTGAATCGGGACTAAATGGAATCGTACACAGTGAGTCGAAAGGCCTATATTGCGTGGAGAGAGATATTATGTAT
CAGCATTATCAAAGGTGGCGTGAGGCAGCTGGTGAAGTCCCTGATAAGCGATCGAAATTTTGTGAGAAGATATTGAAGTTGGACAAGCGTATCACATTCA
ATCGATACAAAGACAGTTGAGCCACTCCTGATGGATTCTTCTCTCCTATTGACTTTAACCAAGTCTAAAGCTTCCCGAAGCAGCAATATGACGATTGCGA
CGAGGTTGAGCCATGCCAACCCCAGTTAATTGCTTCACTCCTTTACCAAAGTCGTGACTGAAATCAACAAGTTTCTGGTGCGGTGATATCAGCAACTGTA
TCCATTACAGAGCCTGCAATTGGCTTCCAATTATTTTTCAGACCCCCCCAAATTGATGTTCCAGCTTCTTTCACGCCATTCCATAAATCTCCCCAAAATC
CACTTCCATCGAGTCCAGATTGATACGTACGTAAACCTTCACCGTGAGTCATATGTAAAGCTGTTCCTTTACCAGATTCATTCGCTTTGACAAGCTTCTT
GTACTTCTCGGGCTCAAAATAGTAGGTAGGACCAGCATTGAGCTGAGCATGCGTCAATCGAACAGGCTATCCATGCAAAACCGTTAAGGTTTGCGCGTGG
CTAAGGTTGACACGAAACGCTTTATACATCTTAGCAGATTTCGAAGCAATCGCGTTAGCTGTGATAAATTATATATAAGCACGAAATAAAATATATGTCA
AAGCTTAAATTCAAAACTCAGAGTCTAGATGAACTAAAACAAACAATTATTCGCGATCTCGAAATGAGCAATGACAGGCTATCCAAAGCCACAATGAACC
TGCGATTGTTCAAATCGGGGAAGGAGACCATGCAATATGATCCTAAGGCATTCATTGCTCGTACTCAATACCCCAACAAGTACGACGATGCAAATTTTCA
GAAAGTGTATGGTGTTCAGAACTCTGACACGATTGCTGGATTTACAAAAACAAAGAGAGTCTTGTCCTTACTTTGAATGCACTCTGCAAAATGGTGAAGA
ATCGATTTCGTGACGCGTTTCAATACTATAACGCAGTGAGAAAGGTACTTAGAAAGCAGAATAAGGAGGAACAATTGGATAAAGAGCTTACGCCTGAAGA
AGAGAAAAAAAACATTAGCTATCAAGAATTGATAGCGGTTCCACAAAACGTCAAGAAGATTATTATGAATACATATGGCGAAATGCTTCTATCTAAATAT
GAGTTAAGCAAACTTACCAAAGCGAAACGAATTGCATATCTACGCCTTATTTTTGACTATGTCACACTATATCTCAATGTCAATTATCCTCTGCGTCTCA
TATGACCCTCAGTCTATCTGAAGAAAGTTGATGGTGGTAACTACCTCCAAGGAACGAAGCTCTACTTGAATAATTTCAAGAACGTTCGCCTCAT