Description :
From Genome Similarity Track
Location :
Scaffold_101:3998- 5565
Transcript NameFunction/comments
Physo_141588putative polyprotein
Physo_141589reverse transcriptase

Sequence
1567 bases(100 bases per row)
AAGAACCGTCGACGAAGAAAGAGCTTGTTCGCCAGGCTCTTCTTCTCGAAGTGTCCCTCGAGTCTTGACCATGCATCATGCGCGTCCTTCGCCGACCGCA
CCAGCGGCAGCTGCGAGTCCTCCAACGCGAGACAGACGATCGCCAGCGCCTTGCGCGACTTCTTGCGAAACGTCGCTTGGTCCGCCGCGGTCGTGCACTG
CTCGAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCCAGCACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGGTTCCGTCGAAC
TTGTTGATGCGGGCGGTCGCGGTCGGGGCGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGA
AGAACACTTGAGCAGTAGTTGGCAAAATGCAAAGTGATTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTT
ACTGGATACACCCTACTGGATTCTCTACTGGATACACAGTTACCTTATCCAATCAGAGAACACCACGTCGATGCCCATCTTGTACCCACAATCTTGCACC
CACAATCATGGCGTAATCACCGTGACGTAATCATCGTCCCGTAATCACCTGAATGATTGCGGTACAACACAGTGAAGGTCACGCCGACCTCACTGATGAC
GCGTTCGCGTCACACGGTCGCTTGGCGAGGCGTCGTCACATCAGTCTTGACAACAAGACCGACTATCGGATGAGCTATCTCATCGATTACGCTCGGCGAG
GCATCGCCGATGACAGCACTGGTATTAGATGCTATTCGAGCTATCACTGGGATCAATTCAATTAGCTGTAGCTCACTAAAGCTAAATAGTTCAAACGTTG
ATCTTGGTAACCTATCGCTACTAAGTGCATGCCCTGATACAGCTCAAAACAACAAGGATCTCATCCTTGGAGCTTCTGGGACCGCTGCGCCCAGCCTGGA
GCCAGGAGAAACGTCGACTGCGGTGTGTAGTAGCAAAGTCGACTGGGGTGAACACGATCCAGGGCCTAACGACGTTCCTACTCAAGCCGGAACCCCCACC
GCCGACGCCGACACTGAATTCCATGATTCGGATGTAAACCCGATCACTGACCCTGAGCAGCTGCTGGAGGCCGACCTATATCTCGGTCATGCACGCCATG
GTTGCAGAAGGGTCTGTCGAGGGTGAGGACACATCGAACGACGTTTCGGAGCACGTAGCAAACGAGATTGAGCTAACCGACTACGCACAAGAGCTAGCGT
TCTTGCCAGACCTAACTGAAGCGTCGGAGACGACATTGGATTACTCTGGGCAGAACGTCCAGAATGACGAGCTCAGTGAGAAGCAGCAGACGGACCTGGT
CGATGTGCTGAAGATCCACGAGAAAATCATGATTGCGAGCGGCAACGCTCTACCGCCTCCAGCCTATGGTGTTGTATGTGACATCAATGTACAGGGGCAC
GCGCCGATCAAGCAGAAGACTCGGCGGACCCCGCTTCGCTTCCTCGGTAAGCTGTACGAATTGCTGA