Description :
From Genome Similarity Track
Location :
Scaffold_103:39975- 44679
Transcript NameFunction/comments
Hyaar_Emoy2809515Unknown protein

Sequence
4704 bases(100 bases per row)
AATAGGCGCCACTTCCGCCTCGACCGGTTCCATCTTCTGATCTCGACCACCACCTCCTTGGCAAACTCATCAATGCCCTCGGCCGCACTTCAGACCTTCT
GTCGTCTCCTTCACGAGCCGGTCAAACGACAGCTCCTGAATGCTCATGCGCGCTGCCTGCACCGCTTCTCGGGCGTCCTGGACCGCCGTCTTGAGCGCCT
CTTTCATCTGGTCCAGCCCCGCCTGCACCGTCTGATGCGCCTTGTCGGCCCACTCCTCGTGCTTGATCTTGCTCATGGCTACATTCAGCGTCTCCATGAG
CTTCTTAATGGCCTCGAGGATCGGCGCCGCCACATTCTCTTGGAACGCAACGGCCGAGCGGCTCACGTCTTCAAAGTGCATCGACGTGGTGCTGGACACA
GCTGGCGACAGCACGCGACGTAACGTTCAAGCAGTCGCCCTCCACGTCTGTGTAATACACCACAAATCTGCCGGGCGCAAGGTTAAACTTCTCGGCAAAG
AGCGCCGTCATGGCCTCGAGAGAGAACGACGTGAGGTCCACGCGCAGACGGTGCAGATCGCCATTGTACTTGATCTTGAGCGCCGTTTGCTTGGCGTTCA
TCGTGAGGGATTGTTGAAGTGAAGGAAATCCATGCAGTGGAGTCTTGGTCATGGTCGAGATCGCAGTGTTGTTTAGTTTAGTAGCTTATATTTTATGCAT
TTACGTTACAATGTGTGGCAAATGATTAGTTTACACAGTTTGGGTGGGTGTGTACGCATCAAAGAGTGGGTGTGTACCTATCAATTTCCTTCTGTAATTG
CGAGTCTGAAGGGAGAAGCTATTGGTAAGTGTGCACAAGGTGGAGTCGAACTTCCCAGCAGCTACTTTCTGTCGGACTGTGTGTGTATGTAAGACACACG
GGGTCCAGTGTACACGTCCTGCTATTTGTGGGGGTTGCGGGTCCTCTCTTCACTAGGTGTTGTGCATAGCAGGTGTCTATTTATTATGCACTAATTGCGA
CTGCTTAAGAGTCTGAGCAGGTATGCGAAATATACGAAATAATCGTGACGGGATGTGGGTGGTACGGATAGCCTATTGGCGACGAGATAGCATGCACCAG
CCGCTCGACGAGGACCTGGCTCGATGCTTGGGAAATCCAAGCAACATACTTAAATTCTAGACAAACATTAGCGCCGCTAATAGAAGATACCGATGATTGG
GTCAAGTTACGAAGTGTGAGTATGGCAGTGTTGAAATATTACCCAATGTGATGCCGGCTGTCGTAAATCACGCAGCCCTTAAAAGTCAAAGGAAGACTTT
TCGGCTTAAAATCTACTTGGTTCGTATAAAAAAGCCACTAGTTTATTCAAACTAAATATATCGACATAAAGAGTTTACCAGCTCACGTGGCAACAACAAC
AGCACAAAGTGTTCAAAAATCAAACGCTATCACAATGGTTGCACATTTGTTGTTGTGAGATCATCTCCACCGCACCACTTAATAGTGTCTCTAAACTAGA
GTGCTACTTCGGGTGGACTAACGCAATAAAGTACTCATTCTCTAAAATTCCACACCCGGGGTGCACCATTTCAAAATTTACAATGCCGCTTTATTCATGC
CACGCTTGCCGCCGTGGCAAACGCATTTTAATGAGTTTTAGCAAGGTCTCATAATTTTTTCAAGGTTCCAGGCACCAGATTTCAAAGAGGGTGTGCGTGC
GAGGAGTAGGTGTAGTTTTGGTGGCAACTTAGAATGTGTAGGTTTTAGAGAGAGGTTTGGAGTCACTCCAAATTTGGATTGGTGGGCCGAAAATATGGAG
TGTTCTTTATAATATAGATATAATTAAGTGGTGCGGTGGAGCGCAAATACTTCAAATCCACTTCTAAATTAAAGATGTAACACTAGATAATGTGTCCCGG
TGGAGATGCTCTAAGAGTGAGCTACACTTTATTTGAGTTTTTTCCATAAATCGATACGAAAGCATTTCTTACGCGAGATATGATACAAGGGTGTTCGAAA
CAGCAAATGTATATGAAGTACTGAACTACTACACCTGTACTATAGTCACAATGGACGCTGCACATCGGTAACTGGATAGGTTCGTACGGCCTTCACTGGT
CATAATCGGAAATGTAGTTCACAGTTCGTATTCGCACTGTCACACTGAAAGAGCAAAAAAAGTTGGCACCGCTCTTGGAGATGACACAGCTTCCTTGAGT
AAATGCAGCATTTCGAATCGCTAAGACAGCAGCATTTACGTAACCCACCACGTTCAACTCTTCCATCTACTCCTCGAAATAAAATAATCGGTTTACTAAT
AATTTCATCTCTAGTTAATTTTCTTAAGATTTTGTAATTGGTTTTTTGAAAGACTGGTTTATACCGATTTTACACATTAATTATCTCTGGTTAATTTTCT
TAAGATTTTGTAATTGGTTTTTTGAAAGACTGGTTTATACCGATTTTACACATTAATTATATAAAGACTGTTTTTCTCAAATAACTGTTTTATTCGTTTT
CCGGGTCTATTACTTTCTGGTACCGTGGCTTTTGGTAAAAATGGTAGATATTTTTTACTATCTACCATTTTTTTAAATTAATTTTAATTGCGAGCCCGAA
GGGTGAAGATATTAGTGACTGTGCGCAAGGTGAATGCCAAACTTTTCAAATGGTACTCACCTGTGTGTCTGTCTGTGTGTGTAATTAACGCTTGGTATAC
CTTACACGTCATACTGAGTGCGAGGTAGCCTGTCCCCTCCTCATTCGTGTCACTCTTTGATTAGGTCACTAAGTGCGACTGCGAAGTGTGCAATGTTCAC
ATGATTGACACAAAAGTGATGAAGGGTGGACAGAGGACAACCAAGCAAATGCTAGACACTAAAGCCGCAAAATTCTGGCGCATCTCACAAACAGTAAGTG
TGATCGGTGTTGATCTAAATTACTTGATATACTCAAATAGTAAGAGGTCTTGGTCACCGGTTTCTCTCGGTAGCAGTGGTAGCTTCTTCCATAGAATTTC
TCTATACTGTGAATACTTGGTTTTGTCGTCGACCGCATTTTGTGGTTGATGGCGTTACCGAGGCGGATCATCCTTTGTCAACAATTTCTAACATTCGTCT
CCTTAGAGCATCAACAACATCCACAAGTATCTTTAACACTGAAAGATCTATCAGCACTTTACTATTTAGCACACAAAACACAACCCATATTCTAGCCGCT
AACTACTACAAATGCAAAGTGAACGTATAGAACTTGATCAGTTTCTTGTACTGAATTACTTATATCAAAGGGCGAGCTCCACGGCTTGCTCCCTTATCTT
ACATGTCAGTTTATATCAATATTTCCATTATTTTTGAAAACAAAATTTATGTTGTTTTGCAGCGGAAGTTTTTCAGACGTTCCTTGGAGCATCGACTGCC
AATGGTAATAACTTTACTCAAATTGCAACATATTTACATCAATTTTCTGTGGTAAAGCGAATAAAAAAAAGATAGAGGATCAGGATCTGGAGCTCGCCCC
TTATATGAGTAATTCAGCCCATAGAAATGAATCAAGTTATGTATATTCACGTTCCCATTTTAGAGGTTCGGCAGCGAAAAAATGGTTCGTAGTATGTGTG
CTTATCAATAAGAGTGCTGATGGTGACTTTATTAAAGCTACTTGTTGAGGTTGTTAATTTTCTAAAATAGACGGATATTGTAACGGGCTGAGTCCATTAC
ATGGTATTTTCAATAAAGTACATAACAAGTGTGAATGCTATGTTTAATAAAGACATCGTAATACTGTGATGTAGAAGTCATATACTGTTTTTTGGTTGAT
ACAGGACGATGACATCAACCAATAAAGCGAGCCACGACAGAAGAACGCAACGAGTGGTGAGCAGATAGTTACAATACATGTTTGCATTTAGGTACAGGTA
AAAGAAGACTGAACAGAATTTATAAACAGGAGAATAACTATACTAAATACAGCTCTACCTTTCACTTTTATCTTGTATTGAAACATTCCTCTGCACGATA
CGTGTACGTGAGATTCTGTGGCACCTGCTTACCCTGTGTTCGGAGTAAGTAGCTTGTACTGTGACAGTACAAGCGATCGGTACCCCGTTACACCTGGTAG
CACTTCGTAGTCCGTCCAACGACTATGAATATGTTGGATAATGAAGCGAAAGACTTCCACCCAACGCACGAGAGCTATTCCCATTTGATTCAAATCTAAT
GGGATGCCGTGGATTGAGATCAACGATAGGGCAAGAAGCGGTCGTTGCAATGTTGTCCAGCCTGGGTCCAGACGGACAACACGCCGCCATCGCCAAGTTG
ATACAGAATGAACCTGACGCTGAATGAATAAATGTAACCTTGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN