Description :
From Genome Similarity Track
Location :
contig_51:399663- 400943
Transcript NameFunction/comments
g8664.t1hypothetical protein

Sequence
1280 bases(100 bases per row)
TTGCGCTTGAGCAGCATCTGCTCCTCGAGTAGTGGCAACAATCCGAGCGGCGGTTTCTGGATCAAGTCGAGACATCGCTGGTTGTCCTGAAATTCCACAG
GGGACACTGCGATGCCCTCGCGAGCGTATCGCTCCTGCTCCAGCACAAACACGTGCTTGTTGAACTGCTGCTGCAGTGTTTCATTTGTGAAATTGATGCA
CAACTGCTCGAGGCTGTTGCGCTTCATCACCTCGAACCCGAAGATATCGAGAATTCCGATGAACGGAGCCACGGATGGCGCCGTTGCGCCGCGCGACTTT
GGCGTCTTTTTGTCGGCACCGGCTGTAGGAGGGATAAGGGATGTCTGCTGTTTGGCACAGGCATTGATACGCGCGATCACATGGTGGAAAAGCTCGCCGT
ACAGATATTTGCAGAAAGCATCCATGGCATTCTTGGCCTGCTCAGGGGTGAGCTTGATCTCCAGAATACTGCCGCGACCGGTAACGGTGGTTTGTGTTAC
CATCTTGTTGGCGAACTCCGTAGCGTCGACACCCAGCAGCATCGCTACATGCTCAAGGTTCACACCAGCATCACATTCTGGGAACACAACTCTGGTTGGC
TCGTCCTCTCGACGATCATCTCCATTGCTGTTATCTTGTGTTGTCGAGCTTTCGAATTGCACGTTGCCGAGGTGAAGAATGGCTGCCAGAAGCTCGAACA
TAGGGCGCTGGAAACTGGCGCTGTCCATTCCAAGCTGCTCCAGACACCGTCGGAGCTGATCAAACTCGGTGGCATCGTCCACTCCGTCCACCTCGACACA
ATCTCCACGGGTGAGGTACGTGTAGTTCCACACGTCGTTCCGCAGCAGTAGTGGCCGATCGGAGTCTGCAGGGTCTGACGTTGTATTCGTCAATGAATCA
AGCCCCGCTAGCAACTGGTAGAAGATGTGGTAGTTGCGCTCGTTAGCTTCCGGGCGTACGAGTCTCGTCTTCTCCAGCAGAAAGTGGCGGATCGAGACCC
CGGCCATGCGGCCTTCGCTGCTGTAGTGGATCTGGATATACTTGCCGAAACGACTCGAGTTGTCATTGCGCGAAGTCTTGGCGTTGCCGAACGACTCGAG
GATTAAGTTGGAGAGCACGACGCACTCCTCGATCTGCTCGTGAACACCTGCAGCAGCAGCTGCCGCCTTTCCGGTACTAGTGCTGGCGACGTGCTTGCTC
GCTGTGGCGAGGTACTTCATGATGTACTTGGAAGCCTCCGTCTTGCCGGCACCGCTTTCTCCGCTGATGACAATCGACTG