Description :
From Genome Similarity Track
Location :
Scaffold_11:399640- 400979
Transcript NameFunction/comments
Aphas_H257_07612DnaJ domain containing protein

Sequence
1339 bases(100 bases per row)
CACTTGTTTTCTTTTGGGTTTTCCGCTTGTCTTTGCGCTCTTGGCGTTTGTCGGCTGCTTTTCGCTCGCGTTCGTCGCGCTCTTGGCGCTTGGCGGCCTC
TTCTTCTGGCGTCAAGAGCACGACGACCTTTGGCGTCGTCTGTTGGTCTGGTGAAGCTGTCGTCTGTTCGGATGGTGAAGCTGTCGTCTGTTCGTTGTGG
TCGTGGGTTCTGGCGTCCAGTTCGTCCAGTTCGTCCAGCAGGCTTGGGTCAACCCCTGCCAGCACCATTTGGTCGCGATGTTTCTTGGAGATGAGGTGAT
TTTGTGCCTGCTTTTCCGACTTGAACTCCTTTTTGCACAGGTGGCACACGAGCACCATCGCGTCCGCCTTGGCGCGGCGCTTGGCTTCCTCGGCCCGCAG
TGTCTCAGCCGCGTACTCTGACGTCGTCGCAGCCGCCTCCCACGATGCCTGGAACGCGGCCTTCTCCGCTTCGAACGCCAGTTTGCGCGCCGCAGCCGCC
GCCGCCTTGTCCGCCGCTTGACTCAGCCGGAGCGCCTCCTTCTCCTGGACGTGCTTGATCATGCGCTTGTCCCGCTTCCGGACGTAGTCGGCCAGCGCCC
GGACGTTGGCGCTGAACGTCTTCTTGCCTGTGTCCCGCGCCTTTTTGTTGTCTTTTTCCATCAGCCGCCGGATCTCGCGGCTCGGCGCGTCCGTCGTCTT
GTACTGATCGAGCCATGAGAACGACTGATCGGTCATGTACGACCGCCAGTAGTCGTAAAAGGCATGCGGAACCTCTGATGTGGAGGAACCGAACGAAGGT
GCGGGCGTCGAGTCGCCGCGCGCGGCTTGGTCGAGGGCATCGATCTAGACACGACCATGGAGTTCGTGGGGCGAGGAAGGGGACGAGGAAGGAAGGATGG
ATGGTACCTCTTCGAATACGCCGCGGTAGACAGAGTAAAAGCCGCGGTCGTCGTCTTTGAAGCCTTTGTAGATGGACGTGCTAGTAGTGGTCGCGATGAG
ATGTGTGGAAAAGCATAAACGAGAGTGCGCGAGACGGCGTACCTGAAGAATCGCATGACGTCGAATCGGTCGTCGTCAGCGTCGCCATCGTGGTGTGTGC
CGTCGTCGCCGCGAAGGATTTGCTCGCGATGGTCGTCGTACCACGCGCGTTCTTGCGGGTCGCTCACCACTTCGTACGCACTTTGGATTTCCTGAAACAC
TTGCGTTGCTGCTTCCACGTCCTGGCCGTCCTTAATCTTGTCCGGATGCCATTTCAAAGCTAGCTTGTGGAAGGCCTTGCGCAGCTCTCCAGCTGTCGCA
TCCCGCTCCACGCCAAGTACCTCGTAGTGACACCGCATG