Description :
From Genome Similarity Track
Location :
Scaffold_38:399595- 401514
Transcript NameFunction/comments
Sapdi_VS20SDRG_10982hypothetical protein

Sequence
1919 bases(100 bases per row)
GGCTTTGAGGACATGATCTCGGTCGACCACTTGCACGAGGGCGCGATCTTGTACAACCTGCGCCAGCGCTTCTTTGGCCTTCTCCCATGTACGCGCCAAG
GCCTCGATCGGCGCTCATGAACAGGTTGATGATAGACACGTACACGGGCAAGATCTGCATTGCGGTCAACCCGTACCAGTGGCTCACGCTGTACAGCCCC
GAGACAATGCAAAAGTACATGGACGGGTCCCGCGAGAGCAAGTCGCCGCACGTGTACGCCGTCTCGATGGAGGCCTTCTTCCACATGCGGTCGCACAGTC
TCAACCAGAGCATCTTGGTCTCGGGCGAGTCGGGTGCTGGTAAAACCGAGACGACCAAGATCATGATGAACCATGTTGCGACGCTCTCGTCGCATCTCTG
CGCGTCGGAAGCGCAGACGTCGATCATCCACCGCATCATCCAGTCCAACCCGCTCCTCGAGTCGTTTGGCAACGCCGCCACCACGCGCAACGACAACTCG
TCGCGCTTTGGCAAGTTCACCGAGCTCCAATTCGACGTCAAGGGCCACCTCATGGGCGCGCGGGCGCACACGTACCTCCTCGAGAAGTCGCGCGTGACGC
ACCAGGCGCCCGGCGAGCGCACGTTTCACATTTTTTACCAAGTGCTCGACGCTGCGAGCTCGCATCTCGCGCATCTCGAGCTGTCGCAAAAGAGCTTCCG
GTACGTCCGCCAGGACAAGGTCCTCGCGCTCGAGCACTCGTTTCTTGAGACGCAGTCGGGCCTCAGCATCGTGGGCATCTCAGAACCCATGCAGGCCAAC
CTCTGGCTTGTCCTCGGTGCGATTCTGCATCTCGGCGAAGTCGACTTTGACATGGTCGCTGGCGACGTCGACTCGTCTTGCGTGCAGCACAAGGCGTCGC
TCACGACCGTGGCCAAGCTCCTCGGCATCCCGCTGGCCGACCTCGAGCAAGTGCTCACGCACCGCACGGTCGCGGTCGGGCGCGAGGTGATTGCCAAGCC
CATGACGTGCGACCAAGCGCGCGACTGCCGCGATGCGGTCGCCAAATCGCTCTACTCGACCATGTTTACATGGCTCGTCGACCAGATCAATGCAGCGATC
GGCGTGCACTCGATGGCGTACTTCATCGGGATCCTCGACATCTTCGGCTTTGAGGCCTTTGACCACAACTCGTTCGAGCAGCTCTGCATCAACTACGCCA
ACGAGAAGCTGCAGCAAAAGTTCGTCCAAGACGTGCTCAAGACGGTCCAGGCCGAGTACGAAGAAGAAGGGATTTCGTGGTCCCACGTGACGTTCGCTGA
CAACCAGGACGTGCTCGACTTGATCGAAGGCCGCCTCGGCGTCCTTAGCCTTCTCAACGAAGAGAGCTCGCTCGCCACCGGCACGGACGCGTCGTTTGCG
CACAAGCTCTCGGCTGTCATGGACAACCACGCGCGGTTTGAGACACCGCGCCTCCAGTCGAGTGCGTTCATCATCCTCCACTACGCCGGCAAGGTGCTCT
ATGACACGAACGGCTTCCTCGACAAGCACCGCGACGCGCTTCTGCCCGACATCAAGCGCGTCCTCTCGGAGAGCTCGCTGCCGCTTGTCCGCACCATGTT
CCCCGCGACTGCATCGACGCCCGATGCGTCCAAGAAAAAGCACAAGCCCGCGCCGCGCCAGACGACGCGCGCGGTCACGGTCGGCACGCAGTTCAAGGAG
TCGCTCGCACAGCTCATGGAGAAGATCTCGCACACCAATGTCCACTACGTGCGCTGCATCAAGCCCAACGCCTTGAAAACGGTACGTCGTCCAGTCGTCA
TCGATGGACGTTATGACCCTTTGGTGTAGCCACATGCGTTTGACCATGCATCGGTCGTCGACCAGCTGCGGTGCGCCGGCGTCATTGAAGCCATTCGCGT
GAGCCGGTCGGCGTACCCG