Description :
From Genome Similarity Track
Location :
Scaffold_178:3995- 10667
Transcript NameFunction/comments
Phyke_g5964conserved hypothetical protein
Phyke_g5965hypothetical protein PHYSODRAFT_504737
Phyke_g5966NPP1-like protein
Phyke_g5967hypothetical protein

Sequence
6672 bases(100 bases per row)
AGAACCTAGTGGGGGGTTACATTCAGGAAATTGTGTGCTGATTGAGTTGCTGACATTTAGGACGGAACACTTGAGctatcgtcatcgtcgaagGCCGGGC
TACTAGGATTCTATAACCCGTGCATTGGCGAAGATCAAACCATTGCCGACGCTCGATCATCGGAGAACTCCGCCACTAAACCATTGCTGTAAGTGGTTTG
ACATGTGAAGCATTCTGGGGAGTTATCGTTGTCCCCCCTCACTGAtgtgtttttcttgtttttgttttttttcaTTGCAGGTATGTGCGCTATACATTCG
ATGACCAAGTGTTTGAAGCAACATTCGACGACGATCAGGCAGTCAGCTTGCCATCACGGTACGCTCAGGCCATGGGACCTGTGGGGAGTGTGTACTAAGC
AGAGTGGCTGGTAAAACGACATAGAAGAGATGGCATATTGAAATTGACGTGCACTAGAAATTGTGTGTGTATGTTGGATGTTTAGACGACATGTAGAGTT
TCCACCTTTACCGACTGGACGAATTGGTCTACCAGTACGTGCAAAGGCAACTCTTGCAGCTGCTTTTGATGGTTGTTCGAGATTTCTAGCGCCatgtgct
gcttcatgaAAAGTACGGCGGCGATGGCATCTAAAAACTCAGAGAACACCAGTGTTGTGCTAATAAAGAATGCATCGGGTTCAGCATCATGGTCGAGCTC
GTTATCGCCAGCGACATTGCTGCGGAATAGCTCAGATTTGAGTGGTGGCGATGACGCCGTGAAAGCCCGGTTCAACGCAGCCAATGCATCGCGAATCTGG
AAGTCTGCCGTGAATACCGGCATCTCTGGCGCAACGTCGTTACGAAGCATGACAAGCACCGATCGAATCGACACCGCCTCGTCGTGTTTGTTGCCGCTTG
CTGTAGTATCAGCTTCCTCATTGTCATGCATGCGCTCCCCCACGTCTTCACACTGGCGCAGTactgaaggagctgcgcaCCTGTTGTACAAACCATGAAG
CTGATCGTGGTGCTTGCTAAAGATgctgtgcagcttcttccccATTAGTTGTGCACGCAAGAGAGCAAGCCATGAAGGTGTTTGGCTAAGTGCCTCCTGT
CGCTCGTGCATCATCTGTTCGTACAGGTCGGAAAAAATGTCTGCGAGAAACCCTGTGCAGTCGGTAGTCACGGCAAGCTCGATAACGCCCTCGGCTTCTG
CTGTCATAACCCACGAATGTGCAATACGAACGAGTAGCTCGACGAATTCTCGATAGAGTACGACTTGATCCCAGGGCACAACTTCAAGCCGAATTGGATC
AACAGGGTTTCTCAAGCGATTTTCCAACGCCAGATCTTCCACAAAAGACTCTGCGATATTCATTGACGATGCACAAGCCAAGGCAGTAGTTCGCTGTGCC
CTTCGTATATCTTGCATAAAATTCTCGAGCTGCCCACTCGTGAAGTAGAAGCCGCATTGGGAGAGTAGTTGCCGACATTCAAAGCTTTCAAGCAGCGTCC
CAGGGTCCTCTGAATCAGCAGGGGCAGTTATTGAAGACCGCCGAGACTCCCGAATGCACCCACGATATAGCGCGCGCAGCTCTGTGTTGATACGCAACGC
GGCGTGCTCCACAGCCTTTCGAGCCTTCTCACGTTTCGCATTGTCCGTAATTGGCAGCAAGTCGTTGATGAACAGCATGATTCCTGCAACGttcgatgaa
gacgaaggcgatgACAAAAATGATGCCACCGATGGCGCAGTCGACTCGGTTTGTGGTGAAGTGAGCGGCGGCAACGCGGTGGGGACAGAGACCGCCATTC
CTGcagtcgtcgctgttgtcgcgTAGCAACCCTCGACGCCGCGATCCTGGTGGAATAGCCCCACGAACACCCTTCCGTCCTCGTAGAAGAAAAGGCCGTA
GCCATCTTTAACATTAGCCTTCCACTCACCTTCAAACCGTGCGCCATTGGCATAGTAGAACACACCATTCCCATGGCGCAGTCCATCGCTAAACTCACCT
TCGTACCAGTTCTTATCGTGAGGAGAATTGGACGATGAGCTGTTCCTGCTAGGCGACACAGGAGCTGCTATACTATTGAGACTCACAAGCCACACGTGTC
GTCCAAAGCCTTGCTGGCAGTCATTCTCCCACTCGCCATCATATCTCTCGATCGGAGTGGCGTTCTCCGACTCATCAGCAGCCATCCACGTCATCACGCC
TTGACCGCATTTCACATCGTCCTTCCACTCGCCAGCATACACGCTGCCATCCGCATAATGCATATGTCCTCTGCCTGCACGTTTTCCTTCGACAAACTGG
CCTTCGTAGCGGATGTTGCGAGCAGCGTCGAACACCAGTTCTCCGTAGCCGTGAGGCAGTCCGTTCTCCCACTCACCATCATACCGAGCGTTGCTTTGAG
CCACCACAAGTCCAGAAGCATTCGATCCGTTTCCACCTTTGTTACATGTATCGTCAAGTTCGCTGTCGCCGCCAGCATCAAGGTCATGACCCAAACTACC
TGACTCCTGGAAGGTGAAAAGTAGCGGCTGGGTAGGGAGTTCCGTGCCTTCACTGTCCACACCTTCCTCATTGCCCTCATTTATCTTTGGGTTTTGCTCT
AATACAATGCCACGGTCTCCGGTAACGAAAACCCCGCGACCATGACGCTTGCCGCACTTGACCTCTCCAACGTACGAACTGCCATTGGGCCACCAGTAGG
TCCCTCGCCCAGTGATCTCATTGTGTGTGAAATCACCTTCATAGACCACGCCACTGTGCTGCCACTCGATGCGACCTGTACCGTGCATGCGGCCACGGAT
AAAATCCCCGACGTACGTAAAGCCTGTGTTGAATTCCAATCTACCTTTGCCATGATAAACGGGTGCATCGCATTCCGGGACTTGCAAAGTCTCGCCTTCA
TATGACCGCACTACATTTGACAGCACACGCGGGTCCAAAGGCGGCGACTCcgaccaagatgaagaaggttTTGTCTCCGCGACGTCCATGGTAGTGTTTG
TTTTACAAGTTCCGGACACCAGTCGTTACACCTGTGCAGGACAAGTAGCTCTCCAAAGggcgtcacttcaacatccgTATTTGCGGTCAGCCATAGCATG
AGATGTTCAAGACATCACCATTTTTGCAGTGCATACAGGATGCAAGCGGTACCAGCATGAAGCCGGATAATGACGAGATCGCACATCGCTGAATTTATCC
TTTTTGCCAGTAGATCATACCATCATATCATGACTGCGCCTGGGTATTCACTTCTCTTTCGACTGTAGAAGTTCGATCGATGCTACAGAACAAAGGCTAG
CTGGCTGTGTACTTGCATATTTCACGTGCCATCACTAGTTACACAGTTATTGCCATTATCGTTCCCCTTTTTTTCTTTATGACGATGGTTTTCCACTTTA
AGTCTGCTTCATTACTCCATTTTGTTGATTGCTCAGTTACATATCATGTAGTACTTGTTAACGATGTCGCATGGGCAGATGCTGGTAAAGAATACTTATA
GCCACTTTGTTCAAGAAACAAATCTCATTCGTATCACTGGACCTCGCAACTACGACTAGCTTTGGTGCAGTTGTACCAGAGTATCTGGTTGGAGACTTGT
GACCTTGTGAAGTGAGCTCTCCGCGGCTCACCCGACCGGGAGATCACTTCACAATTGTTCACATCAAGCTCACGTCTTCGGTCACCTTATAAGCCCTTCT
CCAAGTGACGACAATGAACTTTCGTGTTCTGCTAGGTGCAATTGTCACTTCGATCGCCGCAGTCTCAGTCGAGAGTAAAACTATCCGCCATAACTGGGTG
CAATCCTTCGCTGAGCCTGACCCCGTTACCGTCTCCGATAAAGCTGCAGTCAAGTTTAAGCCGCAGCTTCACCTCAAAGAAGGCTGCCACCCGTATCCCG
CCGTACAAGAGGATGGCTCAGTAAGCGGTGGACTGAAGTGGGCGGGCAAGCAGGGCGGCGACTGCAAAGGCTCCAAGTTGGGCTCCCAGGTCTACGCTCG
CTCCACTTGGTTTGGTGACGTatgggccatcatgtacgcTTGGTACTTCCCTAAGGGCCGTGAAGCTGTTTCCATGCACCCGTACGCAAGGTTCTTCGGT
CACCGCCACAACTGGGAGTATGCTATCGTTTGGATCGACAACCCCGCTCTTGATGACCCGGCAATCTTGGGTGTGTCGATGTCTGCAGCTACTAGCTACA
GTAAACGGGCACCCCCGATGGCGAAATACCTCGACGGTGACAGCTTGAAAGTCGAATATTATAGCAATGCCGTTGTCGCCAGCACGGCGCTGCGTTTGAC
CAAGACTAAGGGCGAGTTTCAGGACTTGGTCACGTGGGACCAGCTCCCGGATGCTGCAAGGAATGCTCTCATCGACACCGACTGGGACACGACACTTTTC
AACACTGCGGGAGCGAAGTTCCCTCTGAAAGACGGTGTCTTCAATGAGACTCTGGCGAAAGCCTACCCGTTGTAGATGAAAAGCACTCTTATAGCAGATT
AATGTCGTGGATAATCTCATCATTGAACTCAAACCTCCAGTTTTGGTTTGCATTTCAACTACCAGTAAAACAATTCCCAAACAAAGGCCAAACGAGAGGA
ACACAAGAGGTGAACGAAGTGTAATTTGTACGTACTTATAGCGATAGTCTCTAGTCTTGATAGTCTTGGTACTTTATGCTGCGCATGGCAAAATCTGTTA
GTACATACTTTAGGCGACGGTGGTCGAGTTGAGTTCCTGCTCCAGTTCGCGCAGGAACACGGCGAGGTAGTCTTGGTCCACACGCCGCATGgtgagtttc
tgctgcaagGATACATAGCCAGcgagcttcagcagcttgatgATACTTGGCGTGgccttgagcatcttggAATAGCGAATGTCATCGTGTTGTAGGGTGC
GGAACTTGGAGCGCACACCTTCGCGGTGTAGCGAGCGTAACACCTTGAAGATGGATGTAAGTTTGCGAGCGCGCTCAGTGTCCGATGGACACTCGCAACG
GCAACTCGCGAGACACGCGCGGATCTCGCGCACAGCCTCCTGCACTTGGTGTCTTGTCGGGGCGCGGTCGGGTGCATCGTCACTCCACGATGGCTTGTCA
TAGTCGTGTATCGGCTCACCCGAAGATGCGCCTCCCATCTGGTTTGAATGGAAGGGTAATGACGAGCTGCGCGGGCGGACAAGCCCCGCCATCAACTCTC
GAAGCTCGTCGCGTTCATCTTTCCCCACTGCAGGTGCAGGGGGCAACGGGGAGGAGGGTGACGCAGGGTCAATCGGTGGAGACGTTCCCACTTCAGCTGC
cttccgcttcttcagcattgcaCCCAGGTCTTCCTCCACGTAAAATGCGTCCGGGCCCTGATACTTCTTAAAGTGGGGTTCGCGGAAGTCTTCGCTGCTG
ACCAACGACAAGTCATCGGACGAGTCATCGTAGCTCTCCTCATctgatgaggacgaagcaTAGTCATTGTCACCAACAAATACGCTGCCACCAGTAGTTC
CCAAGGCCTGCAAATAGGATCCATCAGTAGGCGTTGAGGAAAGCCGGCCTGCTTGGCCCTCTTGCGAAtttttcgagctgctgcggctgtTCTTCAAGAC
AGGCTTGGCCGGCTTCGCTAGTTTGGCTAATGAGTAGCGGTTCTTGCGTTGCGGTGACACTTCCTTCCTCGGGGAAACCGGAAGTGGTGGGGGGGGAGGA
GGACTGGGCGGAGTCTTTGAACGAAGTGGAGGGGTTGAGGACCTAGACAAAGACTTACGCGACCCAGAGCTAGGCCGCGCAGTAACCTCACTAGAAGCCA
TCACACCACGCAGTTCCGACACTAAGTCGTGAGTCGTCAAACCCTGTCCTGAATCCCCAGGAAGTGATGACATGTCCTGCGGATAAGacgaagttgatga
aggtgctTCGCCAGGAACGATGCTTGATCGTTCACCTCTCTCGCCAAAGATCTCAAAGACACTTTCAATCTCCACCTGTGCCGAGCGTTCGCGCACAGCA
TCTAGCCGCTGACGCGACCGCGCCTCTGGTTCCGGCTCGTCGCTATCAATGACCGATAGCTTGCGCTGGGCATCCACGAGGCTCTGCTGCAAGTCACGAA
TCTTCTTTTCTAACTCGTGGATTTCAGTAGCACGGCGCATCGACACCGCAAACTTATGGGTGCGATTATCATCACCGTCGTGCTCCGATCCATCATGTTC
CGGCTGATACGTTGCCATGATTTTTTCGTAGTTTGATGCGGAATAAGGATCCGGGCTCTGGATTGAGCCTTCGCTGTCATACATTGTCGGATAACTCGCT
ACTGAAGCCGGGCTTGCTGACATTCGATCGTCGTCGAAATCGCCGTGGCTGTCAAGGCCAATGAGAGCCTCCTGGGACAAGTGCAGACGGTCTCCAAGGT
CCGACGAACACGTCGAAAGGAACGCCTGTCCAGCCTGTTTCGTGGCTCGCGCCGCCGCAAAAGTGATTCGTGCCACTGAGTCGAACTGGTCAGCCGTCAT
GGCATCCTCCCGCTCGCTATCGCCATCTCGCAGAGAGTCGTGACTGCGATCACTCGGTCCGGAGTAGTACATGGCAGGAGCTGCACCCGTCGTATTGGCC
AGAGCGGCATCAAAGTTTGAGACTGAACTTTCCAGTGCTTCACGAATACTCGTGATCTCGCTGTACATGTCG