Description :
From Genome Similarity Track
Location :
Scaffold_346:39935- 40995
Transcript NameFunction/comments
Phyci_574686Hypothetical protein

Sequence
1060 bases(100 bases per row)
GGAGAGGACGAGGAAGGTCGCGAAGTGTGGAGCTGTGGACAAAATTCGTATGGAGAGCTTGGACACGGTGACACAGCATCCCGAAAATCGTTTGAACGAA
TTGAATCACTCCAGCAGAAAGATATAATTCAGATCGGTGCTGGTAACGAGCACACCATCGCGTTGACAGCCGATGGAAAAGTCCTCACTTGTGGATATAA
TGATAATGGGCAGTGCGGTCAAGGAGGAACCGCCCGCGTGAGCCACTTGAGCGAGATGCCCAAGATGGGGGAAAACGCCATCTCGCAAGTTCACGCTTAC
AACGGGTGCGAGCACACAATTCTCGTGACGATGGATGGCCGCGCAGCAACCTGCGGCTATAACTATCGGGGCCAACTCGGTCATGGGAATACTGCGAGTG
AAAGCGTGCCGAAGATTGTCCGGAGCTTGGAAAACAAGATCGTGCGGCTCGTTTCGTGCAGTTATTACCACACTGTGATGGCCTGTGAGGAAGACGGGAG
TGGTGAGCAGTATTTGTACACTTTCGGTCGGAATGACTACGGCCAGCTTGGTCATAACGACTCCATTGACCGCAAGGTTCCTCAACATGTTGAGGCAATG
GGAGATCAGCACGTAGTTTCAGTCGCTTGCGGGCAGTACCACACGATGGTGGTCACCGCTACAGGCAAGGCGTTCGCGTTTGGCAAAAATGACTATGGCC
AACTAGGAATTGACTCGATGGAGAACCAGTTAGTTCCTGTGCAGGTACGCGCTGGATTGGAGAAGCAGGAGTGCTTGGAAATTCGATGTGGATACTACCA
CACGATCGTTCTTTGCAGTGGAGCGCACTTGTTTGGATTTGGTCGTAATGACTACGGCCAACTGGGTCTCGGTCGCTCCAATTCGAGCTCGACAGCTAAT
CTCCAACTCCAACAGCAAAGATTCTCGTACGCAAGATTAATTGAGGAACTTGAAGGCAAAGACATCGTTCGATTCGCGTGTGGATGCTATCATACTATTG
CTGTCTCGGACAACGGAGTGATGTACGTCTTTGGTCGCAACAACCATGGACAACTGGGGA