Description :
From Genome Similarity Track
Location :
Scaffold_869:39934- 41649
Sequence
1715 bases(100 bases per row)
ACAATCATCCCTTTAGGATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTTCGTAACAGCAAACAAGTTTTCAGAAAGC
TTTGAGAGAAAGCAAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCCAACGTCCAAGTGGATCTGGCTGTCAAGT
TTGAAGACTTTGACAGCCTCGAACATTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGAT
CGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGC
GAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCTTGCCCAGAAGAG
GCGCTGGCCAAGTGGGTAACTTTGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGG
TAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAG
ACCTTAACTGAAGAGGAAGGCGCTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAAC
ACGCTTCCTGTGTGGGTACAACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCA
CAGACGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCT
CCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGG
TTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGCGATGGTACTCATGAGACCTGAGAC
CACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGATATTCTCAAG
AACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGATGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACG
AGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGC
GAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAAC
AAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATT
TGCGGAAGGGTACCA