Description :
From Genome Similarity Track
Location :
Scaffold_220:39926- 42459
Transcript NameFunction/comments
Phyta_totarag5798hypothetical protein
Phyta_totarag5799hypothetical protein PHYSODRAFT_538644
Phyta_totarag5800hypothetical protein

Sequence
2533 bases(100 bases per row)
ACCGTCGTCTCATATTTACCACTCGaacttggcggcggcgctgaTGTACTTGGGCAAGTACACGGAGGTGATTGACCACTGTGAGCAGTCGATCGCTTTG
AAGCCGGCCTACGTGAAGGCTTACTCACGTATGGGTAGCGCACAGGTGCAGCTGAAGGACTTCGATGGCGCTATTGACACGTTCCGACGTGGACTTGAGG
TGGACAGCACGAACGCTGCTTGTCGCGACGGACTGGCAGATGCTGAGCGCAAGCGACGTCAGATGCAGACGACCCCCGCGGCTTCGGCCCCGACGGCTGG
AGGCGCAGGAGGCATGCCGGATCTGTCGAACCTGGCCAGTATGCTTGGTGGgggtggtggcggcggcctAGCCGACCTCATGAATAACCCGCAGATGATG
CAGATGGCCCAGGGCATGATGCAGAACCCGCAAATGATGCAGATGGCGCAGAATATGATGCAGAACCCCGACATGCTCAACAACCTCATgggcggcggtg
gtggcctAGCTCCTagcgctggtgctggtggcgcgGGAAGCGGCATGCCCGACATGAGTGGCCTCATGAACAGCCCCGAGATCGTGGCTGCGCGATCGGA
CCCGGACCTGGCGGACTTCTTCCGTGACGTGGACAACGAGGGCCCGTCCGCCGCGATGCGTCACATGTCGAACCCCAAGGTCTCGCAGCTTATGCAGAGT
GTAATGTCTGGGATGCAAGGTTAGACAGGAAAGCAGATATAGCGAAACAGCCATGCAATCGCTCGCAGACCGACTGTAAATGCCAAGTGGTGAGTGAGTG
AGGCTCTCAACTTGTTTATTTTGTGGCAGTCACGAACCCCAAGCAAACTGTATGCAACAATACGCTATGTGTCACGAGTGTTGTTGTGTTTACTGCTTGA
CAAAGGTCTCAGCGTCCTCGAGGAAGGCCAGGtactcgcgctgctccttGAGGTCGGCGAACTGCGTGATGAactgcgccagctcgtcgtcgatcttgcG
CTCGGCCAGGTAGCTGTAGAATTTGTCCTGCACGTCGAGCTCCAGGTCGATGAAGTTGGGGCCGAAGTAcagcgtctcgtcctcgGCGTCCTTGGCGAAG
TCGCTCAGGTAGCGCACGCGCTCCACCGTGAGGTTGTTGCTAGCCACGCAGTCGAACTGCAGGCCCTTGTTGTCGCGCGTCACGTCGGCCGTGAAGCGGA
CGCCCGGGagttcgtcctcgtcctcctcttcgtcctcctgctcctgttcttgctcgtcctcgtcgtcctcgttgtcgtagtcctcctcgtcctcctcaaG
CTCCACGGTATCTTGGGCGTTGAACTTGATCTTGATCGAGTCGTCGCCCACGGTGACCTGCAGCAGAACGTCCATACCGCCAGCggtctcctgcagcttg
aagaccTTCTCGACCTTGAGTCGCAGATCCGCCAGATCCGGCTCCTCGAAGCAattggccttctcctcctgaATCTCGCGCTGCAATAGGTAAAGCAGTA
GATATTTTTAAGGACTGTGGACGCTAGTTTTTAGTGGGAATTTTGGAGGGATTACAGGACGTACGTTGAGCACGGAGACGAGCGATGACTTCTCGCGCGT
TTGCAACGCACGCAGCGCCACGGACGGCGTGCGGCGGACGGCGGAGAGCGTAGCGACGCGGGCAACTCGAGCGAACATGGTGCGCTTCCTGAAAGATTGG
AGTGTGGTGTGCGTCCACGGCCACATACATAATGACATATGATTGGTCGGAAATAAGCTAAAGTTTTGACGAATGAAAGAGCAGAATGACACGCTTACAA
AGGCATTTTCTAGAAGCTATTATATAGTGACGCTGAAGCCGAAGTGAAGGTGGCGACGGTAATTGAGGCGTGTGCATACAATGCTGTAGTTTTGCTGTTG
GCGATGATGATATTTGTACTCTCGAGCTCCGTGAAGAACCCCTACCACATTTACTTAGCGGTCTTCGTCTCAGCGGGTGGACACTAAAGCTCCACGGTCT
CACTCGTGCCAGAGGTCCCGCTAACTAATACGTAGGGAATATCAACAGTAAATCTCCCATTGAAAAGGCTGAAGAGGCTACTGCGAGAGCCCCACGCACA
CGCTCTCTAGATCGTGGGAGGTACATTTCCAGGTAGTGGAGAAACTGTAAAGAAAAGTAAGGAACTGTGAGAGAAACAAGATAAAAGGCGAAGCTGAGCC
ATCCatttgtattttgcagtcTTCTTagcgtttttttttagctTCGACTTCGTAGAGATAGATACTGTCGAAGTCTTGAGCACagacgtcgtccacgtcg
ttAAGGAGTTTGCTCTTGTCTATTGACGTGGCAGTCAAACCCCAGCGAGAAAGTAGAGGGGCGATCGATCGGTTGATACTTCGTAATTGGTAGGTGAAGT
AGAACTTGCACGAGACTGAAACACTGCAGCGGAAGATCAAGGCGACGGTCGCGATCACCTTCTCGAAATCTACAAGTATAACACACAAAGTGTTAGAATG
GGGTGGTGCGGTTTAGGAGTCAAGTATCGGATA