Description :
From Genome Similarity Track
Location :
Scaffold_113:39925- 47800
Transcript NameFunction/comments
Physo_142370hypothetical protein
Physo_158515hypothetical protein
Physo_158516hypothetical protein
Physo_142372hypothetical protein

Sequence
7875 bases(100 bases per row)
TGAGCTTCTTGCACCCTGGCTCCGTGCACAGCTTCAGGTTTTTCACCGCTGCGCCGTCCCGGTGCTCCTTGCAGCGCTTCTCCCCGTCGACCTCGAACGA
TGCTTCAGCGACGCACGCCGTCCCGTTGCCCAGCTCGAACTGACCGAACCCGTTGCGCACGTGTAGGAGCCGCATGCCGAGCGGTGGCCCACAGTTCACA
CAGTGAGTGGGGATGCAGTTGAACTGCCCATACCTGGCCGGACGCTTCTTCTCGCCCTTGCTGGCGTCGGCCTTGGGCTGGCACCCCTTGCAGAACACCC
GCGTGTTGTCGGGGCCGTATCCAGCGGGCAGGATGCACTTGAACATCTTGCACTTGCGGTGGTCCTTGGATCGGCAGCCGGGCTTGGTGCACTTGACCCC
CGCACACACGAACGGGATCTTGGGCGCGACGCGAGTGATCACCGCGGGGTCCATCCGGTCCGTGTCCACGCAACGTCGGCAGTACTGGAGTTGCCCGTCG
GCCCCGTGCGTCGCGAAACTCTCGCAGGACTTCTTGGGGCACGCAGCATGGGACCGCTGCTTGCACTTGGTAATGGCGCAGCGGCCAGCCTCGCAGATCT
TGGTCCTCAAAGGCAAAACACATCCGCACTGGATCTTGAGGTGTGCGCACCCAGGCTTCCTTATGGTGACTCATCACGCGCTTTTCGATTTTGCTCTGCT
GTCATCTATTTGTCGAGATGCAACATATGATGCAACTGAATCGATGTCATCTGTTGGTCTCGCAAGTTCCTAGTTTTTACTAAAACATATCGATTATTGT
TAGAGTACTAGCCAGCAGTGTTTTAACCTTGTTTCGCACAGAGCGGCGTGTAGTCATGTGGAGAACTAAACAACGTAATGTATTTTTACAAACGGAAACA
GAAAAATCGCCTGCGCGAATCCCTCACAACATGTACGAAAAATATAGATAAAATAACCTACATAATTTTTACATCCATACAAAGATGCCTGTGTACAATT
GGAAATATCCGTATAGTGGATAGTAACCGTAACCTTATCGGGAATAGTAAGCTTATACCTGTAGTTCATTAGAAACCATCAGTTTTTTTGTTATATATTA
TCGTATTTGACTTGAAAGTAAAAAATCGACAGTTTTACACTTTATATTTGAACCTCATTTAAAAGTGGTTCAAACTATTTGATTTATTATCTAAAAGTAG
GACTAGTACAGAGACTAGAATGACATGTGCTTATAATATAAAGATTATTGTGCTCGCCAAGCGTTTTGTCTGCTCGGTTTTCCACGCTCTCAAGGGATTT
GGTATCACCAAATCCTGGTCGATATATATGTAAATCCTTCAGAACGCCTACGGAAAACTGGGCATTCTGGTCGATTTATATATATATATCGACCAGGGTT
AGCCTAAATGACCAATCAACACCTTTAATGAGCTATACACATGTACGAGGCCAGCTAAATACCCCAGCTGGTTAATATGAGAGCGATAGTGCCGTCTCCA
TGCTCGGTCTAATAAGAAGTGACTCGAGGTATATATATCGTAACTTGGGGTAAATAGAGCGCAAATCTCCAAATACCGGTCGATTTAGAGCTAAGATAGG
CAAAATGTGTGGCGAGCACAATACCTAGAAATCGTTTTGAGTTAAGCTTTGGCAACATTCTCTTAAATATTTTGTAAAGAACTTAGAACTTCTCTTCAAG
GGAATACCACCCACTAGATAAGTTTGCTACGTCATCCCAGTATGGTATTTGTATGCAGCCGATGTCAACAAGCTGGCAGGCGACTAGAGTGAGAGCTTAC
TCGATCTGTACTTTGCAGCCACATTTGCTCGCGGGTGCTGGGAGCCGCCTGCCGCAAAGAAAGTAAGAAAAAGTATTAGCCACACTGAAGAACGCATGCT
GCGCTAGCGTGCCAACGCTAACGCAATTTCTTATGCTGTCGAGCATCATGTGCTCAACTTGAAGCCAGTCAACTTCAGGAAGTAAGGCTGCATTCCAACA
TTTCAGCTGAAGTCGATTGCTTTCAAGAATGGTTGAGGTACAATAGCAACGCTATGTTAGCATGCAAATGCACTCACTCGCCCCTTCCATTAAGAATTTT
TACTGGTATGTTGAGCGCGATAGCAATAGCCCCCGACTCTCTCTTCTTCTCTCCATCAAATACAGCCAAAGTGAATTCTCTAAATGCAGCGGGGGCGGAA
GGAAGGAAGCGAGCAGACGAATAAGATTACAAGTCCGGCACGCCGTCGATCTCCGTGTAGCCGTTCTTCTTGGAAATGCGGTCGTTGATGTCGATCGAGC
ACAAACTGGACGAGCTGCCCCACTTCTCGCGGGTCGCGGCGCTCTTCTCCGGGTACTCACGAGCGAGGCACGAGAAGATGAGCGAGAACAGGATCGCCAG
CGGGAAGACCACGAACGCACCGATGCCCCACATGACACGCGGGCCGAAGTGCTCGTACACGTAGCCGCCCATCAGGGTGGAGCAGGCCGCGCCCATGCCC
TTCTGCACAGCGGTCAGTAGGCCGATCATCGTTCCTTCGGTGCCCTCGGGCGACGACTGGAAGATGTAGTTGGTGAACGCAGCCCACAGCAGCCCGAACG
TCATGCCGTGCAGCGCCTCGAACGGGAGCCACACCCACGGGTTGTGCGCGTACGTGTAGACGATCATACGGACGCCGTAAGCCACGACGCTGAAGATGAT
GCAGTTGGGCGTGCCGAAGCGCTCGAAGATCTTGTTGGAGAAGAAGAAGAGCGGCAGCTCCGAGATGGTCTCGGTGGCGATGATGACACCCACCAGTCTC
GCGTCGTTCCCAGACAGGTTGAAGTAGTCTGCAGATTAAACACACAAAAACACAGGTTAGTGATGTCGGTAAACGATCACCGTTGCAGCAATGAACAAGC
GAGCGCTGTACGCACACAAAAATAAAAAGTTATCAATAAGGCCCCCTAGGATACCGCCCAGGAGCACGACGATGTAGAGCACAAGCACGTCCGGTTGGTC
CCAGATGATGGCGAGTGACTGGAGGTAGTCCGTCTTCGCTCCTTCCTCGTCAGGCTGGTATGCGGGGATGAAGCGAAGCAGGATGAAGAGCGAGATGACC
GAGAGACCCAGCACCATGTTGAAGCACCAGGCAATGCCAATGGCAGCGGCCATGACACCGGCGAAGTAGCCACCGATACCGTAGCCCACGGCGCCGTAGA
GCCGCTGCTTGCCATAGACACCACCGATGTGGACGAGCATGGTCATGGCCGTCTGGTCTAGCAGCGACCACGTGGGCTGCGTCTGGAAGTTGGCCACGAA
GAGCATGATGCACATGACGTTGAAGGTGGACACGAAGCGCAGCGAGAACATGAAGAGAGCGGCCGAGACCAGGCAGAAGATGTGAACCAGCTTCTGGTTC
TTGATCACGTCGGCGACGCCGCCCCAGATGGGCGGCGCGATGATGGCGCACACGCACGGCAGCGTCAGCAGGATACCGATCTGCATCTTGTCGAAGTGCT
CCGTGTTGTCGAAGTAGATCTGAAAGCAGCGCGCAGTATCAAGATATCAGTTAGAATAGGGATGATCCTAGGGGTTTACGTCAGGGCGGCAAGACGTACA
GGCAGGTAGGTCTGCGTGGAGAAGGCGCAGTAGTGGATGGCGAAGAAGAGCTTGAGCGGCACGAGCCGCTTGCTCTCGCCGCCATCGATGGTGAACTCGA
TGAGGCGCAGGAGGGCGGACATCTCAGCGGCTTCGGCTCCAGGAGCGGGTGGCTGCGGACTGAGACGGTGGATTGGGCTGGGGTTTGCTTGGTCGCGCTT
GCGGGGCAAATTCCGATGTGAACGGCGGAGATCCGGTGGCTGGCGGAAGATCCGACGCTGGCTGGTGGGGGGACGCTTGCTTGGGGCCCGGGATTTCGAA
TAGTGACTCGCTCGGGTTCCCGGAAGCGGCGCGTAGATCGCCGCGGCGTCTTTGCCCCCGGGTTTGCGAACGGATGGACGGGTTCGCGCGCCTCGAACGC
CGAGTCCTGCTGTCTGCACTCAGATGATTCGCGCCGTCGCACTCGCCGCTGGCGTGCACGTTGTCGCGTGATAATTTGAGAGATAGATAGAGATAGAGAG
CTTCGCGCGCTGCAGGCTAGACAGCTACTGCAGCGATGCCTGGCGGGCGATGCCAACGCCAAGCCCGGCTCGGCCCGCCACGCAAATAAGGCTGCAAGCA
CGGGTCCGAGCATACCTGAAGCCGCTCGGGGCTCGCATGGCGTCCGTCTGGCAGTTGAAGCGAGCGTGGCGTAGAAACGCGAGAATCAGAACTTTTTGCT
GACGACCGCACACGAGTGACTGGGGTTCAGTATGAGTCACTCTAGCGAGGGGGTATCTTGGCACTATCGCGGAGGAGCCAGAGACAGGACCACGCAACTT
CAACTTTGTGTAACGGGCGGAGTTGCTCGTACGCCGGCTGTGCAACTCGACACGCCCTGCAAAGAGATGCAGATTCTCACTTGGTCTCCAGCGCTGGACG
TGGCTGGTGGGCACTCTGCCTGCATCTTCGCATACTGGTCAGTTTTGCCGCACGCTGAACTCCAGCGGAGCGCTGCGCTTCGATTGCTCGATATGTCGTC
CGTGCGATGGAGGGGAGGCGAGCGATTGCAGTGGATCAAAGACGCTATATGACAACGCGGTACAAAGGTGCACCTGCTACTCGTCTTCCTACATCAAAAC
TGTCAACTCCTATCGCTGCTCAGCACTGCGCGCTGACGTCCGTTGTGCCGTAGTCCGCGGAGGTGGCGAGCAGCGAGCTCTCGTCGGACGTAATGCTGCC
CGAGTCCTCCTTGCTGGCAGTTGGGCTCTGTGCTGCGTAGCTGCGTGCGAGGCACGCGAAGCCAGCCGTGAACACCAGCGACAGCGGGAACACGATGAAG
CCCGCGATGCCCCACATCATGCGGCCGCCCAGCGCGCCGTAGATCCACCCGCCGACGAGCGTGCTCAAGCCGCCACCGATTCCGCGCTGCACGGCGAAGA
GCACGCCGATCATCGTTCCCTCAGTGCCCTTGGGGGCCGCCTCGTAAATGTAATTGGTGAACGCCGCCAGCAGCAAGCCGTAGGTCAAGCCGTGCAGGAC
CTCGACCGGCAGCACCAGCCACGGGTGCTGCACGAACATGTACGTGATCATCCGAATGCCGTACGCGATCAAGCTGACGAAGACGCACTTGGGAGTACCG
AAGCGCTCGATGATCTTGTTGGCGTGGAAGAAGAACGGCAGCTCCGAGATGGTCTCGATGGCGATCACCACGCCGACGATGTGCGCGTTGTTGCCCGACA
GGTTGAAGTAATCTACACATCAAACACAGACGCAAGTTAGCCATGCTGATAGACGATCGCCGCTGCAACAATGATCGAGACAATGTCGTACACAAAAAGA
CAAAATTGTCGATAAGCCCCCCTAGAATACCCGCGAGGATCACGATCACGAAGAGCACAAGCACGTCGTGCTGGTGCAGAATAGCCTTCATACTCTTGAG
TAGTTCTCCCTTTTGGTGGTGCTCAGCCTCGTGCTGAATATTCGGGACGTACGTCAGCAGGAGGAAGAGCGAGACGCTCGACAGAATGAGCACCATGTTG
AAGCACCACTCAATGCCAAGGGACGACGCCACCACACTGGCAAAGTAGCCTCCGGCGCCGTAGCCCGCCGCGCCGTACAGACGCTGCTTGCCGTAGTCGC
CACCAACGCGCTCCAGCCACGCCATCGCCGCATGATCAAGAAGCGAGAACGACGGCTGCGTCTGGAAGTTGGCGATGAAGACCATCGCGCACATGAGCGG
GAACGACGTCACGTACTGGATCGAGAAGAACAGGAACGCTGCCGACACGAGGCACACCGTATGCGCCAGCTTCTGGTTGTGGATCCCATCGGCGATGGCT
CCCCACACCGGTGGACTCACAATGGCGCAGATGCACGGAATGGAAAGCAGCACGCCGATCTGCGCCTTGGAGAAGTTCGCCGTCGTGTCGAAGTAGATCT
GTATGTACATGTGCATCCCTCCCGGTCAGCAACTAGCAACGGGGGATATCTCACAAACCGGTAGGGTACGCACCGGTAGATACGTCTGCATGGAGAACGC
AAAGTAGTGGATCACGTAGAGAAGCTTGAGCGGGACGAGCTCCTTGGCCTCTCCGCCATCGAAGAGGAAACCCAGACGAAATCCCATAGTTCTAGCCTGG
CAAAGTCTGCAACGGAGGTCTGCGCGCTACACCGCCAACTGATGAATGGCAGTGTGGGATGACGGCGGACCGAGGTTCAAGCAGCGAGAGCCGATCCTCC
ATCCTGCCCAGATGCTGCGCGAGCGCTGCCAGTCAAGGCCAATGTATCGACTCGATACTATCGAGTGAGAGCTCCACGCAGCAAAAGCTAACTTGGCGGA
CACCTCGCAACTTGGACATTTTGTGCACGCAGCAACCACACATTTTTGACGTCGGTGCACAAAATGTCCGTTACTTGAGTGACACCCCTCCCCAACCAAG
CTTTGATCGTATGAATTTACTATTGGAGGTCATGAAAGGATGCGTAAAACAGGGATCCGTGTCAATCGGTCTTGGTCAGACAATCAATGGGGCCGGCGGA
CTTGAAAGTGGCTCCTGCGCCCGAAGATGCTCACAGGATTGCCGACACCACGCAGAGCGTGGTTGAATTTCCTTGACGGTGGTGAGCGAATAGCTTCCCA
CGACGGGGTGCTCAGATGAAATTTGCGCTGCAGCCTCTGAGTGCGCAATGTTGTCGTGCTAGCAAACACCCAAGTGCGTTTCGCCGGTGGTCGCTAGGTT
GGCCACCGCGAGTATTGACAGTTTCTGCGACCAAGGGAATTACTTTCAGGGGCCGAGCCATGCAGTCCGCCCAGATTTCACAGCAATGGAAAAGTCCTGC
AGCGCGATATTATGTGTGGACAAATAAGAGTACCAGTTGATCCGCTCCACAACTGCCGATCGAGCCATCGACCCTGCCCTGCCGTCCCTGATGCTGTCTT
CAGGTCTCCGTCGCCGAGCTACCAGAACAAGCCTTCGCTCGAGCAGTGAGCAGCCTCGGGAGGACGCCAGCGACTCCTGCCCCGTCCTCGGCGAAGAGGA
TCTGCTCCGCAGCAGCACGCGGCCGCAGCGGATTCGAGAGGTGAGGCTAGTCGACAACGGCGTGTTCACCACGAAGAAGAGTCTGGCGCAGCGCATTCGC
AGCCGCAAGAACAGGTTCATCCAGCGCGTGCTTGTGGCGTGTCACTTTGCCGAGCCATCGAGAGATGTCACGTTCACACAGGCCCAGCACAGCACCAAGG
CAGCAATCGACCAGCTAACGGCAATCCGCGACGGTCTCTTCGCCCACTCGCAGAGTATCGTCAGTAAGTGTGGCAATGACTTGAGTTATTGGGTTGCTTA
GCTCACGAATGTTAACCCCTGTTGTCAATGGCTCAAGCAGACTTGTCGATGGCAATCTGCAGCTTCACCAACAACTCGGCCCGCCTCCATGACGACTCCC
AGGACGCGCTGGCTGACGTCACTGCGGAGGGATACAAGATCCGCGACTGCTATCTCGCGTTCAGCGTAGGTTGCCGCTCTCGTCATTGTTGAGTAGTATA
GTACCCAAAGCCATTCTGTTGTACGCACAGGACCAAGTAGAGAAGGAGATTCTGGCGCAGATTGACCGCCGCCTCGCCGAGTTCGAGCAGGTCCAGTCCC
TCGTCGAGGAGCGTGCGAAACTCGTGCTCGACGTGGACTACGCGAAGCGGACAGTGAGTGGGGGCTGATCAGCCGATTGATCGCATAAATGACTAATCCT
GCTTGGACGCAGTTGGCGGTGGAGCTGCAGAAAGGAAACGTCAACCGCATCGCAGAACGCAAGCAAGCGGTAAGC