Description :
From Genome Similarity Track
Location :
Scaffold_29:399222- 401744
Sequence
2522 bases(100 bases per row)
ACCATTTCAGGTGTTGTCATTGATGGCAGAACATTCGCAGTTCGCATCCATGAGGACGCGCTGGTCAGTGATATAAGAAAAACCACGGGAACACCGATAA
TTTTGAGTTGGCTTTACGAGATGACGGCGATGAGCTGGAGGAGGACTTGACTTCATTCCAGCACAGCCATTTTACCAGCTCCAAACGACTAGCTTGAGGC
GCCAGTTCCATTGAACAGGGTAAGCAAAACCCGTCTCCACGCTACCGATTGGAATGGAGACTTGGAGTTCCTTCCACGGGCAGGGATTGAGATGTGTCAT
GATTAAACTTCTGGATCAGACTTGTATGTCTGAAAGTGAGCTGACTTTTACGTTGGCTCAAACCAGCAGACTAATGAAGGCAGTATAATTCGAGCAGCTT
GACGGGACAAAGCTGCTAACATGTGGATTTTTAACTTTTGGCGTTGTCGTGTGGCCAAGGCGCCGCGATTTACTTGTTCTTAAACGATCTCTTGTACGAA
ATCGATGCGGTGATTCTGAAGCTGCTGCGGAGATGATCTATTGCAAACAGTAGGCAGCGATGCAGAGCTGAATTGCTACAGCTATTCTGACCGTGTGCGG
CAGGTGTAGTGGCGGCAGGCCAACATGATACAGCGAAATACTACTGCTATGATAGCGTTATGATCGACCGCTCTCTGCAAGTTGGTGATTGTGCTGTGAT
CGATTTCTTGAGCACCGAAGCCGCGTTTAGTCCGGGCGAAGTCCCGCAGAGCAGCAGAAAACGCGGATGTCGCCGAAATCGATGTGGTTAAGACCACCAT
TAACAACTCATGCCGTGGCAATTCCGGCTGTCAGGAACCTGAGCCCGAGCCGTGCAATTGTTGAGCAATGAACTAGGTGTCTACAACTACATAGCTGTAG
GTTAAATCAGTAATGATATGTCCTTTGTTGGTCCTGCTATTTGAAACAACACAACTGTGTACTCAGCAGACATGTTTGTAAATTTCACCACACACTGCAA
GTGCTGTTTGCATAATATCCAAACATGAGTTCGCGTAAAACCGTCTATCCTGACCCATATCGTCTGGCTTTAGGATATTTTGCCTAGCCCCACCAACATG
TTAGTAGTTTTTGctatacactaacaaacagttttcgaacgcttgcgtttCCTACTGCACTTGAGTATCCCTCGGCTGTATAAAATAACGGAAAAAACGT
GACTGATTGTTGGGCTGATCGCGATTGCTCCTGGGCCTCGATGAACTCGGTGTATACGAACCAGCCTACCACTTGTTGTGTCACGGACTATCCGAAATGT
GGTGGACCCACGATACCAAATAAAATTCGAAATGAACCATTTTCAATCCCTTTCGCTGGACGTACAGTTTGTGTGATTTGGATTGGATCCTGGAATCAAA
TCGTCTTTGAGCGACAGATTCTCGTAGGTGAGCTATCCGCGGAACACAAGCAACGTGCGAAGGAAAGATGCACTTAGTAAGCCTCCTTGGAAAGTAAAAA
AAGTCCTAACGTTACAGCGTTCATAAGAGTGCATTATTATACTTGCACGCATCAACCTTTTGGCAGATTATGTATTGAGGAAAGTTTGTGATGTTGGTGG
CAAATGCCGAAGTGAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN