Description :
From Genome Similarity Track
Location :
Scaffold_249:39920- 42592
Sequence
2672 bases(100 bases per row)
CGTTCCTTGCGCGGCTAATCTCATGTAAATCTGCTTCACGCATATCATATAGCACAAACACCTTAATTGCGAAGTACTTAATAAATCCGCCGTAGTAATT
TAAACTTCTTTAAAATGAATGCATCGATCTGCACGTCCGAGATTATAAGCTGTTCAAAAGCGATTCCAAGTCTTTCACATTATCTTTTAAACATGCAAGC
AATACCTGGCGCCCCATGCAATCCCTTACGACGTACCCGAATCGTTTAAAAAAATCGAGCGACAAATTATATTTGTCACATAAATCAGAAATTCGCTCCA
CTTTTTCATATAAGAAGGTCCAAGGTGTGGCGTATATTAATATATCGGCGATATATAATCTTCGACTTATAAATTTTAGTCTCGTGTCGGTTAAGAGTTT
GTCTGTGATAAACTAACCAGCCAGCTTTAACGATTCAGCCGTGATCGATCCAGGATCTACACTGATTTTCAGAAATCTGAACAAAGCGTTGTCGATAAAG
CGCTGGCAAACCTTTTAAAGCGTTTTTCAAACCAAAATGCATCCATGATCACTCCAATAAACCTGTTGGCGTAGTGAACGCGGAGATAACTCATGCCCGT
TCTGTTATATGAACCACCCAAAATCTTCTAATCATATACAAGTAACAATAGCATATCGCCTTTTCCATACCTTATGGTAGTTCAATAATTAGTGGCATAG
GATATGCAATCAGTATTTCAAACTGATTCAACCGCATATAATTATTGCGCAGATGTATATCGTCATCATTTTCATTGAAGATCACCACAATTGATCAATC
TTATGGTGTTCTAAATGATTGGATGATCTTGACCGATTGTTATCCCTTGATAAGATCAGCTAATATCTCTTGAAAATTGAATGCTACAGGCCGCGCTCTT
TGTGCAATCGATTTTTTGCCTCTGACATTAATACCACGAACTTCTTCACGCTTCGCAAGAAGTAGAAACATTCCCTTTCCTATGATCAACCTCGATCGCT
AATATAATTTTAGGCGTAATCGCTTCCGGTAGGATCAATATGTGTTGATTGACGTCCTCAGCGAGCAGATCACCACTTTCGTAATAGTATACTGCCTATA
AGTTCATGCTTCTATTCTATTTGACATATCATCGATGAAGATCGTAGTAGCCTTATTTTCCTCTTGATCAATCTGTTTTTGCATATGATCTACATGTTAA
ACTTGTCCATTCGTATTGATCACAAAACGTAATCATACCAATCGTTGATTTTTGTGTTTAGATGATATTTGTCCCCAGATTGATATTGAGTCTCATTCTC
TTTTGTTCCTTGTATGTTGGATAGCGCTTCGATCTTCTCAGATTTTCACCCCCTTATCCTCTCATTTCATCGGAAAGAATTAAATATTAGTTGATGTGGG
ATACTATGGGTCGTTTACGAAAGATCCTTTCTGCTGTTCCGGTTACTCCTCATTCCGAGCTACAGTCGATTCATAAGCCAGCGTCTGACACTCATTTTAC
CGATTTTATCCAATCGAAACGTACCTTAGTGATCGCATTATCATATCTGCAGCCATCTATCAACCTAACGGATCTACGTGACGAAAGAACACGCCGATCA
AAAATATTAGTTAGCTGCAAATATTTAATACCACTCGGTACTATATTCACCGTCGGTATCCAATTTGAATTTCACCTTACCCATAGCTTAGCCCGAGTAC
ACTCGCGCTGATCCTTACTTTACTTAACTATCCAGCTGGAATCCTTTCATATTGATCGTCAGCAGGATCACCTGCATAGTCGATTGGTATGGCGGTCTTT
ATTCCAGCTAGATGCAGTTTTAACTTCGATAGGTAGGGGGTTTCATCCGCCATATTTAAGAGATGTCCATCCGGAACCATAAAAGACATACCTAACATCT
ATATTTTGGCCAGATGAATTACTTAACCAGGCATATAAATATTGTAAGGTCGATTCAGTAGACGTGACCTTGATCTTGGTACGTCCTTTGGTCGTGTATA
TGTTCTCATTAATAATCACACATTCCTTCCTTTGATTCTCTTAGATGACACACCTATCTTACGAGCAAAGGTGATGTCGACGATAGAGAATTTGACTTTT
GAATCAGCTAGAAAATTGGTTTTTTAGTTGTTGAACTTCCATACTGCATTGGCCTACTTGACAACTTTTTTCCATCTGTGTTTTTTTAGTAGCCACGTTA
CTAGCCCGAGCTAGATCAAGTTCCAACAGTGATTAATTGTCATACTCATCCACCTATTGCAATACTCGATATATAAGGTAGACAATTTGAACCAAATTAA
AAAATAGAAGCCATCACGTTGATCCGTTTGTAAGCAACTTGGATCCTTGACCTTTGATCAAACAATGCATACATGAAGAGCCTAGAGCGCTCGACTCGTA
CGAGGTTCTACCCTGGTGAGCTTCCTAGTTCAACGTATCCTCCAATTTTAGCGGGATAATTGCAGCATGCTTAGTCGGGACAAACCGCAAGTGGTATGTC
AGACATTTCCCGACTTTATAATTTTCTCCTCAAGCTGTGGAAACATCTAAACACTTGTCTGAACGATGTTCTTGGGGCCACACTTCTGGAGTGCAATCTC
CCATAAAACCCGCGATTTTCATTATTAGTCGATCCACAATAGGTGAACGACTTGATCAGCGAGACTCGATCC