Description :
From Genome Similarity Track
Location :
Scaffold_2571:399- 2893
Sequence
2494 bases(100 bases per row)
CCTGCGGATCATAGTACCGCTTAAGACGTCCACGTAGAGTGTCGGGTGCGTCGTCATTGATTTAGGCATACCGGTGGTGTACGACGCACCATGCCTGGCC
AGGACTGCGTCCGGTCCAATGAAGTGGTGCTTCAGCTTGTTGCGGCCGACAGAGCTGACAGTGGCTAGCGTTAGACCCCTCGTGTCTAATAGCACTAAGC
CCCCACCTTAAATGCACTTAAGTTATCTCTTCCATGTTTGTCAGAGTACTCCTTCTGTCTGTCTTGAGCTGCTGCCATGGCATTGCGGACCCTGCTGATC
ACGCTCAGCTTGGTATCCACAAATTATTCCACTTGTTTCCGCAACGAAACCGGTCTCACGTCGGAGACCTGGGAGGAAAGATCTTTCCGAGCCTCTCCCC
AACATAGAATAGAGGATGCAGTGTCTCCTCGAAGCGAGAGAGCACTCTGTGTGCGAAGCCATTCAGGTAGAATGGCGTGAACCCCGTGGACGCGTCCATC
GCGTTGTTGAGCGCAAACTCAACGACTGGAAGATGCGTCGATCACGTACGTGGTGCGTCCGCGCACACACTGCGCATAGAATCTTCGAGCACTCGATTGA
CGCGCTCTGTCTGACCGTCTGCCTGAGGATCATCCGCAGTGGACATCTGCAGACTCGTTTCTAGTAAAGGGGACAGCCTTTTCCAGAACGTAGCCGTGAA
CCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCAACGATGAACAACCCCGCGGTGTGTTCACCTGTGACGGTAACG
GGTACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACAACAAAATCCCGGTGTTGCCGTGTCCGTCGGCGGGGAACCGAAAGATGAAGTCAA
GACTCATCGACTTCCAACAGTCAGCCGGAACGGGCAGGATCTGTAGTGGAGCCGAATCGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTT
CACGTATCGTGCGACTCACTTGTACATGTGGGTCCATCAGAAGACCTGAGAGACCGACAAGAAGGTCTTCACGCGACCCAACTGGCCGCTGGAGGGCGCG
TCGTGCGCCTCCACGAGGAAGTCGAGCGTCCGATCCTCGTTGTTGGGTACGACCACCCGTGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGCCAT
CCTTCAACTCATATCGGTGGAGCCGGGAGCGCTGTCGCGACGAAAGCCAGTCGGACTTCGCGTTCGTTCCTGCTGTGAGGAACTTAACGATAGGCGCGAT
AGCCTCATCTTCCCGATACGCCTTGCGTATCCGATCATGTAGATCAGTTGTCACCCGTGTGGTGTGGGCCAACTCGTAGTCTGGACGCCGAGAGAGGGCG
TCCGCAAGCACGCTGAGCTTGCCCGGCTTGTACTCAACGCGGAAGTTGTACTCCGCGAAAAGGGCAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCAA
ATTTGTCGCCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGGCCGTGAGCCCAGAAAATGAAACCTGAAACTTCACAAAGGCGTACTTCATTCC
CAGAAGTTATTTGTCGTGAACAGGGTAGTTCTGTTCGACGGCTTTGGGCTGCCTGGACTGGAATGAGATGGCTCGTTCATGTCCAGCCGTGTCGGCCTGC
AGCAGTGCACACCCGATGGCATAATCGTAGACATATATGGCTCGTTCATGCCAACCGTGTCGGCCTGCAGCAGTGCACACCCGATGGCATAATCGGAGAC
ATCGCAGACGACGCTTATCGCCTTAGTCTCGTCTCGTCAGGCAGGGCCAGGACAGGGGCGTCTTGGAGAGTGGCCTTGATGCTGTCAAAAGCATCATCGT
GCTCTTGCTCCTAGCGCCAGTCGGCCCCCTTCTGAAGGAGGCCCGACAATGGCTTAGCAAAGCCCGCGTACTGTGCGTTGTACGTTTAAAAGTAGTTGGC
CAAGCCCTCCACTTTCGAAGATCCTTCTGGGATCAAGGCGTAGGCCATGCTACTATGGCCTTGACCTTGTCTGGGTCAGCCCAAACGCCCACGCTGCTTA
CGAAGCAATCGATAACCTTAATATCTGGTTACGCGAAGACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAGCACTCGACGGAG
GTGCCCCAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACAACGATGTCGTTGAAGTACATCTGTACGAAGGCGCGCATTGGGATA
AACAATTGCGTCACCAGACGGTTGAATGTCGCCGGAGACAAGCCCAGCAGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTCACCGTGGTGA
GCGGGATGTCGCTCTCGCGCATCAGGATCTCGTAGTATCCGTCTACCAAATCCAGCGCACTGTACATTCCGCTTCCGGCCATGTTGCTCAACAA