Description :
From Genome Similarity Track
Location :
Scaffold_2465:399- 1756
Transcript NameFunction/comments
Phyag_g12502hypothetical protein

Sequence
1357 bases(100 bases per row)
ACGGAGAGGCTAGTTCCGACTGTAACGAGGTTTCGGCGCGGCCGACCATTGTGGGTCCGACTCACAAATGTGACAGAAACGGGTACTCAGTGCTCTAAGC
ATGAGTCTTTTGTGCTATGGGTACCGATAGGCGAGCTTCCGAGGGCGCCCGGATATGTGCGCTTAGAGTCGGCGAAATACAAGGAGTGGCAGGTTATCGC
CTACGCCTACGCCGAGAGCCGAGACGAAACCTTGTACAAGCGCGAACGAGAGTTCTATGAAAGTTGGCTAGCAGACCAGCCACCGGCCGTCGAGCGGCGA
CACTACCCGACGCCTCGGAAGATTCTCACAAGGGGCACCGAGGCCTCGGATGCAACAGAAGACCATCGGCTGGACTGCACCGAAGGCTCGGGGCGACGCT
TGGTCAATCCTAGGTCAGACAGGATCGATGCTGAAGTATCAGTCGAGGTCACGTGTGACACCTGGggtgacgaggaggtggTATCCGAGGCGACCGAAGG
ACCAGATGATGTGCGAGAGCGTGAAGTCGTTCCGGACAAGACCGGCGCTGACGAACCTGGAATGATCGAGGGCTCTGTGGTGAAATTGGATGCCGCATAC
GTGTCGGCAATGCACGAGATTGCGGCCGGggtcgttgctggaggagacgatggGAACGACAGTGCGGCCGAGCATTTGCCGAATGAGATAGAGCTCGCCG
ACTTTGCGCATGAGTTGGCGGTGTTGCCTGAGGTCACCGAAGAAATCGAGACTACTTTGGATTACACCGCGCCGAACGTTCAGAATCCTGAGTTGGATAG
CGGTCAGCCACGAGACCTCGTTGCCGTGCTGAAGAGCCATGAGAAGATCATGATCTCCAGTAGGAATGCCCTACCACCACCGGCATACGGTGTAGTGTGC
GATATCGACGTGCAGGGGCATGCACCGATCAAGCAGAAGGCTCGGAGGACACCGTTACGTTTCCTCAGCAAGCTGTACGAGCTTCTGAAGGGTTTACTCC
AAGCCGGGCTGATCGCCTTCTCAGACAGCCCGTGGTCGTCACCGATTGTGATTGTATACAAAAAGAACGGCATGGATATCCGCCTATGCATTGATTACAA
GAGGGTGAATGCGGTCACCGCAATCATGGAGTATGCCATGCCGTTGGTCGACGATCTTCTGACTGACATGGAGGCTTACCTCTAGTTTTGCTCCCTGGAC
GCTGCAAGCGGATTCTGGGCCATTATGATGACCCACCGAGCTCGCAAGATCTCGGCGTCTGTGTGTGCACTGGGGCACTTCGAATGGCTGCGTATGCCGT
TCGGCCTCAAGAACGCGCCGATGATTTATCAGCGAATGATCGACAATGCACTTTGGG