Description :
From Genome Similarity Track
Location :
Scaffold_200:39895- 47055
Transcript NameFunction/comments
Phyta_totarag5479hypothetical protein PHYSODRAFT_553558
Phyta_totarag5480FAD synthetase, putative
Phyta_totarag5481T-complex protein 1 subunit zeta
Phyta_totarag5482hypothetical protein PHYSODRAFT_284638

Sequence
7160 bases(100 bases per row)
GAATGCTTGTTAGAAGTCGCAGGAACCGCAATTATTTGTCTATATGACCATGAATCTATTACTAAATTACTGATGTAACCATCTTTCTATTTGTATATTA
TAGCCAGCCGACGGATATCAGAGCTCTGTTTAAACGTTTTTAAACTATTTAAACCAGCTAAACAACTAAAATATTTCATAATTTTATTTTAAACTAtaat
atttaaaaaaaaaaagttgTAATTAAAAGGTCCTTATATGTTATAATAGTTTTAAATTAAATCATGAAATATATTTTAACAAAACAAGCACCACCATTGA
CAAATCGCCCCGCCTAACGGCATGCCCGACATTCGAAGCTGATGTTGACATGTGATAACGCTACTGGTACTCGTTGTTCTCACTTAGGtcagaagctgca
gaatacttcgaagtacagaatattaataataaacTTGTAGGCTACGAGTCGTAGTGACAAATTACATGGTTGAAGTTACTGGTTCGATTTttgacttgct
gctgcctgcctCCACTATCAcattctccagctccttcacaCGTCGTCACCTGCACCTTGACAATAGGACAGATGTCAGTGCAGTCGGACGCGTCTAGcgc
gcaacagcaacgcgaGGTTGCGATCAAGTTAGCGGAGATGGAAGACGCGTTGTCGCGCGCGATAGCTGCATTCTACAGTGGAGCGACGTGGAGGGAGGGT
GGTCGCTTTCCTGGGTTGCGAGGTGGAGGTAGCGCGTGAGATAGTAGCAAGGATGGCGCAAGATGAATTGGTGGAGCCAACGTATGTCATGGAAAAGGAA
ACCTACGTCATATTAACCACTTCGGCCCGATGACATGCAAGCAGCATTTGGCCAGTGCGACGCAGCGCGAGTGGAGGCAGAGCAACACCTTGCTCGACTA
TCCGCTATGACAGTGACGGGGTTGTTGACGCAAGAGATAGACCCAATGGGCAAGGTCATCCTTGGGGCGCAGAGAAAAAAATTCAGTAACTTCAGAGCCT
GTCTGAAAAGCGACAAAAGTCCATCATGTTCCTGCAGTCAGTGCTGGGTAGTTTCGAAAGGGTGAGCTCGGATGAATTCTTGGACGTGTACTTTTCAAAA
ATTAAATTATCTTCTTaaacaacagcgacgacgtctAGGTGGGTATGCTATGGGGGGGCAGCTAGTGTTCACGGCTTGCAGATTGTGACTGCGTTACAAC
GACAACGCTGTATCATACTGGCAATCGAAGGAAGGAAGATCGCTGGCGGAGGCTAATGAGAGCAACCTTGGAGGCGAAGGATGGTGTGTGTTTGTGCAGG
AATCGCGCGTGGATCTGAAGTGAGTACCAAGTACAGCATCATCGTCTCCGCCTCTAAGAAAGATCTAGTTAACCTGTGCTACACGAAATACTACAAAAAT
GATAACCACAGGCCTTGAAGTATCCGGATTGAACTAGCAGCTACAGACCTCTTAATCGTGCTGCATACACACACTAGGGTAAGATGCTTGCCAAAGAGAG
TTCTCTATTCAACCTCTTCACAACCTAGGGGTTCGACCTCGTGTCGTATTAATACCCAGTGCACCTTGCACTATGCAGTGCATTCGGGTATCAGCTTGAC
GTACCTCTGTGGTGGCGCCAGCTTCTCTGTCTCACAGGGGTGTGGCAGCGAGAGCAGGAAGCGGGTGCTGACACTCGATGGTGACTGCAGCGGCAGGAAA
CTAGGTAATAGTACTATCCGGTAGCACTACAGGGTACACGCTCACATCAACTTTCATACAAATTTAATGTGGGGTGCAACACACCAATGTACCGAAATGC
CGGTACTCGCGCAAAGGCCTCGGCGCCACCATCGAGATCGCAATCTACCCCTCGCTCGCCCCAGACACAGCGAAGCCTAGACATTACCGAGCATCCATGA
GCTACCGCGGCATGAACCCCAACGCCGAGATCGTGAGCAAGTCGCAGGCACTTATGGTCAACGTGAGCGCCGCCAAGGGCCTCCAGGGCGTGCTCAAGTC
CAACCTTGGTGCGTGCGTCCGTCTccctctccatctccaacAGACTGTCCACAACCAACACATAATACTAAAGATCTCCATTTCTAACAAATGTTCGCCA
TAATAATTACGATACACAGGCCCTCGTGGCACACTCAAGATGCTGGtaggcggcgctggccagATCAAGCTCACCAAGGacggcaacgtgctgctgcacg
agatgcagatccagcacccgacggcggcgctcaTCGCCCGCGCGGCCACTGCGCAGGACGACGTGACGGGCGACGGCACCACGTCCACTGTGCTGTTCat
cggcgagctgctgaagcaggcgGAGCGCTTCCTGGCCGACGGCCTGCACCCGCGTATCCTGTCGGAGGGCTTCGAGCTCGCTAAGGACGAGgcgctgcgt
gtgctggaCACCATGAAGACCACGCCCGAGGACATGCTCAAGGACCGCGAACTGctctgcagcgtcgcgcgCACCTCGCTGCGTACCAAGCTGGACCAGA
AGCTGGCTGACCAGCTGACGGAGATCATCACGGACGCTGTGCTGACGATTGCCGTGCCGGAGCGCCCGATCGACCTGCACATGATCGAGATCATGCACGT
ACGTGGCGCGTGCTTGAAAAGGTGGCTGCTATTTGCTGAGGAAGCTGACGGTTTTTACGGTGTTGATTGGAAATATTCAGATGATGcaccagagcagcag
cgacactCGTCTCGTTAAGGGACTGGTGCTGGACCACGGCTCGCGCCACCCGGACATGcccacgtcgctggagaacTGCTACATCATGACGTGCAACGTG
TCGCTGGAGTACGAGAAGAGCGAGGTGAACTCGGGCTTCTTCTACAACAGCGCTGACCAGCGTGAGAagatggtggaggcggagcgcAAGTTCACGGACG
ACAAGGTGCGCCAGATTATTGAGCTGAAGCGCGAGATGTGCacggaggagaacaagaaaaGCTTCGTGATCATCAACCAGAAGGGTATTGACCCTCTGTC
GCTGGACatgctggccaaggaggGCATTCTGGCCTTGCGCCGTGCTAAGCGCCGTAACATGGAGCGGATAACGCTTGCTTGCGGTGGTATGCCCATCAAC
TCGACggacgacatggacgagTCCATGCTGGGTTACGCCGGCAAGGTGTACGAGCAGACCCTCGGCGAGGAGCGCTACACGTTTGTGGAGGATGTGCAGC
ACCCGAAGTCGTGCACGATCCTGATTAAGGGGCCGAACGAGCACACGATTGCGCAGATCAAGGACGCCATCCGTGACGGTGTTCGCGCTGTCAACAATGC
CGTTGAGGACAAGGGTGTCGTTCCCGGCGCTGCCGCCTTCGAGCTGTCTGCCCACGAGGCGCTTAACAAGTTCAAGGGCACGGTGAAGGGCCGCGCCAAG
CTCGGTGTGCAGGCTTTCTCGGACGCTCTGCTCGTGATCCCTAAGGTGCTGGCGGAGAACTCGGGTCTCGATGTGCAGGACACTCTGATTGCCGTTCAGG
AGGAGCACCAGAATTCGGGCATGCCTGTCGGCATCGACCTCTTCTCGGGCGAGCCCATGCTGCCGGAGCAGGAAGGTATCTGGGACAACTACCGGGTGAA
GCGTCAGTTTATCCACCTCGCCACGACGCTGGCTTCGCAGCTACTGCTTGTCGATGAGGTTATGCGTGCTGGCAAGCAGatgggcggcggcggtggcatG
CAGCCCGAGCAGTAGGTAGGGATGCGGATGCGTAAGTAGTTTATTTCCCACACCAATCCATCTGCTCGCCACTCACTGAGTCATACTACAGTAATAAACC
GAGAAACCCCACAGAATAATGCGAGCTAAGTTAGTGGGTATGAGTGAATACCTAGATCTATTGCCCACTGTTGCCTGCGTCATCGCCATAGCAACATGTA
GGATACAGCCAGAGCAGCCTTCGAGTCACGCTGAGAGGTTGGAAAGAAGGCATGAGCTCGGAGAAGGACGCGATACGACTGTCGCATGTGAAGCGATGCC
AAGCTCAGAGAGCTCCCATTCGCTATGGCAACATGGTGACGTATGCTGGGGTCGTTCAAGCAGCTGATATTGATGGTCGATCGCATGAAAACCCACAACA
CCACGTCGGAAAGAACAAGTTTGCCTGGAGCCTCCAGTGGAGGTGCATGAAATCCGTCTGCACACGTCACATGTTTCTTCTCGAACTTCGTCTGTTCACC
GACTCTTTCCATTGGCTACCGTAATCTCAATTTCCCATTCGCTAAAAACCATTTTATCGCCCAATCCGTTTCCAGATCATCATCTGAGCCCCACGTCAGA
AGTTTACGCCGACAGTCAGTCAACAACGTCCAgcaacggcggcagcaacagactCTTGTCGCTTCACCTCGCCATTCCATCGCCTCCAGCGGCTTTCAGA
CGTCAAATCCACCGCGACAACCTCTTTCATCGTGTTGGCAATCTCCAGGCGCTTCTTTTGAGCACTTAATCGCCGTGTAACCCCTCGAAAAACGACTGTA
TTCCGACTCCAGGAGACTTGTCTTGCACTTCGTCTACAGACCATAATTCCCTTCTTTTCGACGCGTTTCCAGACTCTAAATCATGACCAAGGATGCCAGT
ATGAGGTCCACTATACTTCGCTTCGATCTCTTCTTTGCTGGCGCTGATCCGGCAATGCAAAAGCGACTgcagaaggcgctggacgtgaTGCGCAGCGCTA
TTGACATCTTCGGCCTCGAGGGCGTGTGCTTCAGTTTCAACGGGGGAAAAGACTCGACcgtggtgctgcacttgctccgCATTGTGGTGGccaagcgcgt
gctggaggaggcgcagTTGGCACATGTGACGGCCCAAGAGGAAGCTGAGGGCGGCTCCAAGACGACTGTTACATCGCCGCGGAACAGTTTCGTCTCGGCA
GacttgctgcaagaagaggagctggaagctcgTGTCCGAGAGCAATTGCAACGGGTGCCAGTCATGTATTTCGACTCATACGACCAGTTCCCGGAGGTGC
GGGACTTTACGGACGAGTGCACCAAGAAGTACGCACTCAGTTGCCATGTGTACAAGTGCTCGTTTGTTGAAGGAGTGAAGGATATTttggagaagctcaa
gatcaaggGCGTGTACATGGGAGTGCGTGGTGGAGATCCGTACACGGATGACATGGAGCACTTCTCACCGAGCAGCCCGGGATGGCCGCCGTTCCTGCGT
GTGAACCCGATCTTGCAGTGGACCTACGCAGATGTGTGGAGTTTCCTGTGTGACTGCCAGTTGGAGTACTGCTCGCTGTACGACCACGGATACACATCAC
TAGGAAACATTTTCGATACTGTGCAGAACCCAGAGCTCTGGCGGAAGGGCGAAGACGGCAAAGAGGGATACTACCTGCCTGCCtacgagctcaaggatgG
AAGCTCTGAGCGCTGCGGGCgacagaagaaggcgcacACGACATCAAAGTCCGAGTAAGCTGGAAACTTGTCGGTCTTACTACAAGGTCTCAAATCGTAC
GTACAACCACTATAACCCAGACGAATAGAACCAGAGAAGAATTCACATGCAAGGCCTAGCTCATTCATACACTGATTGTGGTCCTGTCTAATAGCGGCGA
CGCGACCGCGAACGAGAACACGAATGTCTCCTAGACGCAGGAGATAGAGACGACGatcgatggcgacgacgatagCTACCCGGAGACCGCGACATGAGAG
CCTTTGGTAGCTCCGCTCTTCTGGACGAGCTCTCATACCTACGACGATCAGCTGGTGATCGTGAACGAGATCGGCCGCTGCGTTGTTGTCGATTTGCAGG
GCGCGAtcgtcgaacagcagcatctcgactTCTTCCCGAACGACTTGGTGGTGAACGAGAGCGGGAACGTGAACGATGCCCTGCATCCTCAACATCCTTA
TTGTGGTGATGGCGAGGGTGGCGTGGTTTTTCGTCGTCCTCCTGATCTGTATCATGAGCATGGCTGCGTTTTGCCTTCTTATCTTTcttgcgctccttct
tctccttctttttGAGTTTCTTGGCCACCTTCTCAGCCTTACGCGCCTCCTTCCGGGCAGCCTTGGCCTCACTCTCCGTCAGCTGCTCATTGATGGTACC
AGGTAACGCATACGTCGTATCTGCCTTGCCACTCGCGAGTTGGTCCTTGTATCTCTCAGCCAGCGTACGTTTCGGTCCAGTCTCAAAGCCCGCAGCTTCC
ACCAGCGCTGCACCCAGTCCTTCAACGCGTTCCACATCCATGCCGtcacgcgctgcttctccacgcttcagcagctccttcatctccgaCGCACTCAAAC
CTTCAGCTGGTTCATGATGTCTCCTAGGTGCGATGCCTCTACACACCCAACACAATGTCAAACACCTCGTAAGCTTCTACCACAATAGCCATACAATTGG
CCACCTTCTAAGCGACGTACAGAGCTTCGTTCATGAGGTCTTCGTCCCGCTGCTTGGCCAACGtcagctccatctgcagcgcctccgctCGCTGCGAGTT
GTTGGCCTTGGCGTACCATGACAGGTCCTTTCCCTTCTGCCAGCGCCCCACAGGCGCCTGCACCGAGTGGCCCAGGTAGTTCTCCCGGTACTTGTCGTTC
CTGACATCCTCCCACTTGAACTCTACCGCGTCGATATGTAAGAATAAATAAACCGACCATTAATATGCTACACTAGCAACACGACGACAATAGTAAACAG
CTCGTACGGTCGGCGCCGCCGCGCGTGCCGCCCACGCGATAGTTGGTCTTCCCAAAGCTCATAGCGTTAACGCCACTTGCAAAATGAAGATTTTATGTGT
GTCACACGAGGTAGTGTACATTCTGTGGTGTAATTTATTGTGACACAGAATATCACGTGCCATTAGCGCGGTATCTTGCACCGGTCTCTTCCGCATCATA
TTTCGATAAAACTCAGCGGCCACTAACGCAGTCATGTCCGGCAGCTATGGGTCCAacggaggcggcggtggcatcTTCGCTGCTGGCAATGGCAACAGCG
TAACAGGCGGAGGACCAGACCCAGCCAACGTCAACAACTACAGCACCTTCTTCGCGGCGGATCCGgtgcgtcagcagctcctgcgcaATAATATAGATCC
ACCAGACACCATAACAATAATAATTAATTGCGTATTTTGGTTTTCAATGACAACAGAGTG