Description :
From Genome Similarity Track
Location :
Scaffold_11:39888- 41565
Sequence
1677 bases(100 bases per row)
AAATTCGACACATATTTGAAGCAGTTTGCCAACCCCAAGCCAAAATCCTTCTTTCGAACTCCTATCTATGATTCTATGACAACTGCTAGCAATGAGGGCA
TTGCCAACTATGTCAATGAACTAAGTGAATCGGGACTAAATGGAATCGTACACAGTGAGTCGAAAGGCCTATATTGCGTGGAGAGAGATATTATGTATCA
GCATTATCAAAGGTGGCGTGAGGCAGCTGGTGAAGTCCCTGATAAGCGATCGAAATTTTGTGAGAAGATATTGAAGTTGGACAAGCGTATCACATTCAAT
CGATACAAAGACAGTTGAGCCACTCCTGATGGATTCTTCTCTCCTATTGACTTTAACCAAGTCTAAAGCTTCCCGAAGCAGCAATATGACGATTGCGACG
AGGTTGAGCCATGCCAACCCCAGTTAATTGCTTCACTCCTTTACCAAAGTCGTGACTGAAATCAACAAGTTTCTGGTGCGGTGATATCAGCAACTGTATC
CATTACAGAGCCTGCAATTGGCTTCCAATTATTTTTCAGACCCCCCCAAATTGATGTTCCAGCTTCTTTCACGCCATTCCATAAATCTCCCCAAAATCCA
CTTCCATCGAGTCCAGATTGATACGTACGTAAACCTTCACCGTGAGTCATATGTAAAGCTGTTCCTTTACCAGATTCATTCGCTTTGACAAGCTTCTTGT
ACTTCTCGGGCTCAAAATAGTAGGTAGGACCAGCATTGAGCTGAGCATGCGTCAATCGAACAGGCTATCCATGCAAAACCGTTAAGGTTTGCGCGTGGCT
AAGGTTGACACGAAACGCTTTATACATCTTAGCAGATTTCGAAGCAATCGCGTTAGCTGTGATAAATTATATATAAGCACGAAATAAAATATATGTCAAA
GCTTAAATTCAAAACTCAGAGTCTAGATGAACTAAAACAAACAATTATTCGCGATCTCGAAATGAGCAATGACAGGCTATCCAAAGCCACAATGAACCTG
CGATTGTTCAAATCGGGGAAGGAGACCATGCAATATGATCCTAAGGCATTCATTGCTCGTACTCAATACCCCAACAAGTACGACGATGCAAATTTTCAGA
AAGTGTATGGTGTTCAGAACTCTGACACGATTGCTGGATTTACAAAAACAAAGAGAGTCTTGTCCTTACTTTGAATGCACTCTGCAAAATGGTGAAGAAT
CGATTTCGTGACGCGTTTCAATACTATAACGCAGTGAGAAAGGTACTTAGAAAGCAGAATAAGGAGGAACAATTGGATAAAGAGCTTACGCCTGAAGAAG
AGAAAAAAAACATTAGCTATCAAGAATTGATAGCGGTTCCACAAAACGTCAAGAAGATTATTATGAATACATATGGCGAAATGCTTCTATCTAAATATGA
GTTAAGCAAACTTACCAAAGCGAAACGAATTGCATATCTACGCCTTATTTTTGACTATGTCACACTATATCTCAATGTCAATTATCCTCTGCGTCTCATA
TGACCCTCAGTCTATCTGAAGAAAGTTGATGGTGGTAACTACCTCCAAGGAACGAAGCTCTACTTGAATAATTTCAAGAACGTTCGCCTCATGGGTGCGC
AAATTATTAATCTAGATGGAACAGCGATCAATCTTATTGCTAACTTTCTTCATTTTTTTTTCAGGCTCTCTCGGGCA