Description :
From Genome Similarity Track
Location :
Scaffold_66:39883- 41991
Transcript NameFunction/comments
Phyci_9807Hypothetical protein
Phyci_94295Hypothetical protein
Phyci_514719conserved hypothetical protein

Sequence
2108 bases(100 bases per row)
CATGTCCATCCACATGCGCTCGCAGCTCTGTACGTCCGCCTCCCTGCGTCCTTGCGTCGTGTGCCTCTGCCTGACCGTCCGTTGGCCGTGGCTGCAGTCC
TCATCCGCCCGCAGGCGCTCAAGCTGAGCTCGCGCGCCATGGCGACGGGCAAGAAGCTGCAGACGCGCAGCCAGGCACTGTCGCTGCGTCTGCCGGCGCG
TTCGCTCACGCGCACGCCGCAGCTCGTCGTGGCGGGCGCCGTGCTGAGCGCCTCCGTGTCGCTGCTGCTCAAGGAGTCGGCGCTGTGCCAGGACGCCATG
CTGCTGGCGGCTGCGGTGCGTGCTCACACCCTCCCGACTGCAATGCCATAGCGCATACACTGACCTTTGTCATTTGCTGCTGTTACCCCAATGCAGGAGG
GACCGTCGGGAAGTGGAGATCCGGACAAGAAGAAGAATGATCCGGTGGAGCAGATCATCGACGTAGTGCTGGCCAACTGCGGCGAGCTGACGCTGGCGGG
GGGTCTCGGCTTCTGCTCGGGCTACGCTCTGAAGCAGGTGGGCAAGGCCGCGGCGCTGGCGGTGGGCATCGTCTTCATCATGGCGCAGACGGCCGCCTAC
AACGGCTACATTGACATCAAGTGGGGCAAGGTGCAGAAGGACATGATCGCCAAGGTCGACCCCAACGGCGACGGCAAGATCGACAGCGAGGACGTCAAGC
TCTGGTACCGGAAACTGCTCAAGATCATGAAGACGAACTTGCCGTCGTCGGCGGGTTTCTCCAGCGGCTTTGCGCTCGGTATCTACTACTCGTAGGTGCT
TCAAGTGCCTTTTGAGTCGGCGCGTGCCCAGTGCTTGTTTCCTCTTCATGTATCCTGGTTTCATCTTCAGCATATGGTGCAAACAATGTTGTTGACAAAA
AAAATATACATCACATTTGCTACAAAATTTTGCCTACTCCGTTGGGAAGGCCTTGGCCAGAAATCCGACAATGATCGATCGGTCGTCGGCGCTGGTTACG
CCCATGCTCTTCAGCTCGCGTGAGAATGCTGGTACGCTGCTGATTCCGTTGCTAATGAGGTTCAGCCCTAGTGTAGCGTACAGAATGATTTCTGGCCGAG
TGAACGATAAAAATGTCTGCTTGGCGCTTTCTGAGCACGTCGGAAAGCAGTCCTGCCACATCCTTTCACGTAACCGCGACTTCATGTCGTTGTCCGCCAC
CTGGACGGTCAAATTAATTGTTAAAAAGGCGATCTTCAACGTCAGCATCCTGTTGAGAATCGTACCGACACAGGGATGGCGGCCGGCATCTCGGCTCCAA
CGGGCTCCGTCTATCAGAGTGATGGCAATGCAAAAAAAACGTTCGTGTCAGCATTCAGCAGCAAGCGACAAGTCCATGGCTTGTCGAGAAGGGGTGAAGG
CCCTACCGACAAGCCAGCCTTTCGGAGCTCGTGGGCACGGAGATGGAATCCCCGCGCGGTCAACTGCGTCGCCTACAGCAAGGACAACACCAGCCAACCA
ACGACCACATCCCAACAGTGGGTATCGTCCCGCAGGTATCTCCATGTCCAAGCAACGGAGCGCTATCGTTCTACAGCTACAACATGCACTCGCTAGTCGT
ACCGCCGGGTCCTTCTCGATGTAGATCCGGTACGCCTCGTTCGTCCGTAGCCGCGGCGTGTATAGCTTGGTCTTCCACTCCTGCAGTAGCCACAACCCAC
GGGCACAAGTGTAAGTTCTAGTCGACAGCAAGGCGACGTCATCCAGCGCCAAGCCGCACAGCACAGCACCTCCGTCTCGTCCTCGTCGTAGTCGAACTCG
ATGGGGGCGATCCAGCCTCTCTCCAGCAGTCGGGCGAGGATATGGCCGGCCATCCGTGTGCGCGCCTCGCCCACCAGCGTCGTGGCTGTGGCCGTGGCCG
TCGGCGCAGCGGACGCGCTGCCGTCCACGACCAGGTCGTCGCCCTGCTCGCGCCTGGCCGTGGTCATCTGCGTGGTGAAGAGCTGCACGCCGTCACGCTC
CAGCCACTCGCGCAGCACCGTCTCCTCCATGAACTCCATGTCGTTCTCGTCCGACATCTCCAGGATGCCTGCGTGCTCCAGCAGCACCACGAACTCGTCC
TCGCTCAT