Description :
From Genome Similarity Track
Location :
Scaffold_142:3988- 9262
Sequence
5274 bases(100 bases per row)
TAAGAGACTCTACGAGTCCAGAAGTCTTCCTCTAACTAAGGAGTTAGGGTATCTCTGCTACACTTGGTAGCACTTGTAGTCAATCTACACCTGAGTCTGT
TAAAGAATGTTCCTCTTTAAGGATGGAAACAAAGATAACCCTCTCTGAGGCCTAAGGATTAGCGCTGGAGAAACTCAGAGCGCTAGTCGGGAACGAACAA
GTGGATCTAATCCTTGCACAAGGTTCTGACGTGATTCATACACGTCTCGACGCTTTATGCAGTTTGGGTCCACTTTGATTGGGCAAGTACACGATCATTT
GGCATCGTCTATGCCTACTCGGTATGTCCCCGTACCCGATGAAGAGCCAAGGGATCACCCCCTTGTCTTAACTGTAAAGACATTTGAGAGAAAAGAAGGG
GAGAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGCCATGAACTCCGCTATGCTCCGGTCGGATCAACAGCGAGTTGAGAAGGCTATCTTGAAACTAG
GTGGTCGAGCCAGAGAATGGGCTCTCACGTGTAGCACGTCGGTAGACGAAGCTTTCCCCACATGGGATTTTTTAAAACAGCAAATATCCTGAGAATTGGC
TCCTCCTAATCAGGCATACCGAGTGCATTATCGTTTCTTATCTGCCCGTCAGGGCAAGAAAGAACTATCGGAATATGTCCAGTAACTGAGCATTCTAGTC
GCTGCCATGCTTTGTCCCTTACCAGAAATGGTTCTTGTTACCATCTTCATGGAGGGCCTTCGCACGGGCGTGGCTCGAACGGAAGTATTCCGGGTACGCC
CACCTCCTTTGAGGCGGCTGTGGATATCGCGTTGGACGCTGAGTTCAACTTTAAGGCAGCCCGTTTTGGCACCCATGGGTAAAACCCAAACTTGTCGAAC
TCTTTTAGCTCATTCAATAGGCTGGAGACTATGACCCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTATAGAACAGCATCTAAATATTC
GACATTGTTTCACGTGCGGAAGCACAAAGCATCTGCGACCTAATTGTCCTTTAACCAGGGCACGCCTGGCTACTTCAGGCGGAACTCCCGCCGCTAACCA
GAAGTATGGTACGGTGCGGGAAAACGTAGACTCTCAGTAGGCGCGGGGCACCCTGCTGGGGAGGAACTAGGTTCTTTTGAGCCTTTAGGAGGTAGTGGAG
AGCGGAATTTAGCCCCAAGGTGTCCCGTGCACTCTAACACGGGGCGTGATTACAAGCCAGTCTTTTTGGTCGCAAACGCGACTATTAAGGGATTTGACAA
ACCCTGGTCGATTTTGATCGACTTTGGGGCATCCTATAATTATGTCAGACGCTATTCCCTTAAAGTGAATCCACGTTATGTTGGGGCGCTAAACGAGCAC
GGGAGTGATACGATCACTGTTCGCTTGGCTACAGAAACTCTAGTCACCGCATCTAAAGTCCCTTTGAACTTGGGTGTGAAGTTTTTCAATTTTGATAGTA
TCGAACGCTGTTTAGTCCTTGATTTGGAATTGAGATATGATCTCATTTTTGGTATGGCTTGGCTTGAGCGCCATAAGCCATGAGCCATGTATCGACTCGA
GGTCGAAAATATTAGGCGCCACGCGCACTGTCCCTAGCGGAACTATATAGAGTCATGAACCCACCTCTGCTAGGAATCAGAAGCGTTATTGGTGCGAGCC
ACTGGCTGACAATGTCAGTGTGCTGGACATAGGAATGTCAGAGCTAGTTGATTCTGAAGATTTCAAAGACATGAGTATAGATCAAAGCTCGATGTGTGAT
TGTGAAGTGGCACGTACTCCGCTAAGTGATAGTCGTTGTGAGAGCAACGCACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAGTCATCGAGGGTTTA
TCCCATCAGATGAGCGTGGGGTGGCACGTAAGTACTCACTGAGTGACGTTTGCTGTGATAGCGACGGGTTGAATGCAAATATTGACGTTGTTGGTGAAAT
ACCAAGGCATCCCGATCCCGGCTCAGCGGATGCACGTGAAGTGGTACGTAATCCACGTGATGAAGACGTCATGTCCAATAACTCGTCATCGGATGTCAAT
AGTGACGTCATCTCTGGCTTAGAGAAAATCACTTTTTGACGATGATATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTGTCATAAAGTGATGAT
GACTGTCAGCTGTATACACTTGTCAACGGAGTGATTGGTGCCTATGATGGTACAATTAGCCTTGGGGCTATATCCTCGTTAAGTTCTCTTTTAGAACTCG
AAGTGTCACCGGTCGATGAGTTTGATCACTCACTAAAGAATAGAAACCTTTCAGTGGTGGTGGTCATTCGACCCGACATCATAGAGTTGAACTCTACTTC
ACTTTTGGATGAAGCTGTTCTGGGGGACACAAAAGCAGCACTCAGTGCGCGCAGTGGGTCATCAATATTGAAAGACCCTCATGATCCCTTTATTCCTTAG
TCAAGGAATTTCAAGATGTGGTGTGCCACGACCCACCCTCGGTTCTACCTCCAGACAGAGGTGACCGTCATGAAATTGACTTAGTTCCTGGGACTAAATA
CAGTTTCACACGACAGTGGCCCTTGTCTAAGGATTAATGTGATGACATTGATGACTTCTTCCGTGTCAAGCACGAGGCAGGAATGGTACGTGAGGGTAAA
TCTCCACATTCGACACCGACATTTTATGTCAAAAAGCCGAACGGCAAGTGGCGTATTGAGCATGCTTATAACAAGCTTAATGCGGCTACGATTCCGGCAC
AGTCCCCCATTTATCGAAAGGATGTTCTTCAAAAAAAACCTGGTTGGTTGTACTATGTATAGTGCACTCGACTTGGTCGATGGATATTATCAATAGCTCA
TGCGAGCGAGTGATATTCTGCTTACAGCAGTGAGCACTACGAGTGGTATGATATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATGCCCCGGCAGT
ATTTAATCGTCTGGTGACGCAACTGATCCGCCCACATCGGGATTACGCACAGACGTACTTTGATGACATTTTTGTCCAAAGTCGTGCCGAACATGGTCGC
TCAGATGTTGAAAGCCACATCGATCATTTGCGAGCCGTGCTCGAGTGTGTACGCACTACTAAATTGTACGCCAACGCGTCTAAATGCATTTTCGGTGCAG
AGGAGGTTCCTTTTCTAGGATTTTCATTGGTAAGCGCGGCCTTATAGCAGATCACGCTAAGGTCAAGGTTATAGTGAACTGGCCGATTCCTAAGAATCAA
AAAGACTTACGCAAGTGGCTTGGCCTTGCCAATTACTAACACAAATATAGTGAAAATTACGCTGATATGGCTCAACCATTAACTGATCTCCTTAAGAAGG
ACACAGTTTGGCGCTGGGACAACACCCACGCTGACGCATTTCGGGCTATCACGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATTCCGAGTA
CCCTTTTAGTGTTGTCTACAATGCATCCAATTTTGCTATAGGCAGCGCCCTGTTACAAACTAATGCTGCAGGTCGCGAGCGAGTTATCGCATTTGAATCT
CGTCAGCTGAAAGCTGTTGAAAAGAACTATCCAGTTCATGATAAAGATCTGCTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTTCATCTGCTTGGAT
CCAAGCCATTAGTCGTCTATACGGATCATGCGTCCATTGCGCACAGCGACACAGTCGCCTAACCTCTCTCAGAGAATGGCTCGGTGGATTTTCTTATTTG
CAGAATATAACTTCGAGGTGAAGTATAAGCCAGGACAAAATGTGCTGTCAGATGCTCTCTCTCGCCGACCTTATTATGAGCTTGCTCATTTCACGACTTT
GTCGTCTTCTATTGAGGAGATCATTCGTGTGGCCTATCCACAGGATCCTCAATGTGCAAAATTATTTCACGCCTACCGGAGTGAGCAATACAAAGACTCG
TACAGTCAGTTATCGGCACGCTTGCGGGCCAGCCTACATCGATATTCATTCCATCGATAATCACCTCTTGTGCTATCGCACAGATGTAGCGATATCGCTC
GCATTGGTGTGCCTCACAATGAGGATATAAAATATTGAATCCTCTTTGAGGCCCACAATACTACCCTCAGTGGGCATTTGCGCCGGGAAAAGACCTATGG
CTATGTGAGTCAACACTACAGGTGTCCCAAACTCTACAAATGGGTGAGCAAATACGTGCGTACATGGGAAACGCGCCAGCGAGTCAAACTCTCGGCACAT
TTGAGCTGCGCTACTCGCTAGTTTACCTGTGCCCACAAGGTGCTGGGATTCCATCAGTATGGATTTTGCGTTCGGTCTTCCCAAAGACTGTGACGGAAAA
CGGGAATTGTGGTATTTGTTGACCGTTAAAGCAAGTGGCCCACTTAGCGTCATTGTCGGATTCGATCGATGGCAAGGTACATCTATGCTGTTTATCGATC
GTGTGTTTCGTCAACACGGGTTGCCACTGGCTATCATCTCTGATCGCGACCCTCGCTTTACCGGCAGAATTTGGACTTCCATCTTCAAGGTGCTTAGTAG
CGATTGGACATGTTCACAGCGGATCATCCGCAGACCAGTGGTCAAACTGAGCGAGTTAATTGCGTCATCGGCGATGTTCTTCGCAGTGTTTGTTCTGAGT
CGCCACGGACTTGGATCTCGATGATCCCTGTCATTGAATTTGCGTTGATCAAAGCTGTCCATGCCTCAACTGGCTTTACTACCTTCCATGTGTATAGCCT
CACACACACACACACACCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGCGCTTGGGGGAGAGTCAGCTGACAAGCTTGCAGAAATCATCCCTACCA
CGATGCAGAAACAAGTGAGCGAGGTTCTCGCGACACACTTTAGTGTCCTATTACGCGTTCGTGATGTAATGGTTGATAGCCAGGATAAACAAAAAAAGAA
CAAGCTGATGCTGAAGACAGAGGATGTATTGATTCTTATGAAGTTGTAGAGCAAGTCTTACTTAATGCTAAAAACCTACCTACAAATGTAGTGTCTTCCG
TTTTCAATACAAAGTTGCGCTCACGCTTCATTGAGCCGTTTATAGATATTGCTAAGCAAGGACTTGCCTATACACTCAATCTTTCACGCAAGTTGCGCAC
CAACCCAGTGTTTTACGTTGGCTAACTTAATCATATCATGATCCTTCTCTCGTGGACCTGAAGGCGCTTGCGCC