Description :
From Genome Similarity Track
Location :
Scaffold_1019:3988- 6687
Transcript NameFunction/comments
Physo_145322hypothetical protein

Sequence
2699 bases(100 bases per row)
GACGAGCAAATTTGCCAGCTTTTGGATTTGGCTGCGTCCTTGTCCTCTACGCCGGATGGCGCGCTGCTGGTTCAAGCGAGCACGCGCGGGGGGACGAAGT
GAATCCCTCTCTGGCGACTTGACGTGGAGGTCGCTGGACGCAAGTTGTAGCAGCCGTTCGCCGCGAGGACAGCCCCGTCATTTGCCGTCAACCCGCGCTG
ATACATGCCATGGCGCGATCGGGCTGTCCCCGCGCACCCGGCCGCGGCGCCCAAAGCGGGATTCCTAATTGAACGGGCGGAGGCGGGTGTCGGAGCCGAG
TGTGTCAAGTTGTGCCCCACCAAAACCGCCCTCCCTATTAAATCAGCCCCACTGAAACCGCGAAATAAGAAAGCGGCCGCCGCCGCCGGCCGGCCAGCGC
TCGCGGTGGATTACTTACGAGGTGTTTCGTGGTGAGCTTGTGCGAGTAATGGATCTGCGACTCGTCCAGGAGATCGACTCGTGGTCCGCCCAGCGAGAAC
ACCAAAGAAATTGGTGCGCGCCGAGCCGAGCTGACCGGAGCTGAGGCCGTCGGCGAGACCAGGCCAAGCGTTGCATTGCAGACATGGCTACTCGTTATCA
GGGACGGTTTCCACCAGTATCTTTCGACTGACAGAAGCCGTTAGCGCTATCACCCACGCGTATCCAACGACGAAACGTCCAGCGTGGTCCGGATATAATA
GTACGCGGCGGCGATGGCGACGGCGGCAGCAGCACCGGTGCGACCTGTACCGGAGCGATCTCTTGGTGAGCTCGTTTGGCGCGCTAATGGATAACACGGC
AGCATAGCGCGCAGAGTAGCTCCGAACGGATTTTATCCAGCCTGCATGCCATCCTGCTGTCGGTCTGCCTCAGCGTGACTGCAATTGTAGGGCCCCTAAT
ACTAATAGTTGATCCCACGGCAGCCGCGCCACGATGCAAGAGACCGCTCCAAGCGGGCCCACGCTGTGACCGCTCCGGCCAAAGCCGGCGTGCCGAGCTT
GGATTCCCCCCCCCCTTTCGTCGCGGCAGCTTCAGCAAAAGGGAAATATCGATCGCGGTGGGGCTGGCAATCACAGCACTGCTGTTTCCGTCAGCGCAGT
TCGTTGCGGATGCCGAACCGCGCGCTGTTTGAGACGAACGCCGCCGCGCGCGGCAACGTGGGGCTCGCCGAGTTGCACTAATTTTTGAACTGCCTACCAG
CTGCCGGCGCGGCACGTTGGCGCCCATGTGGCGGTCGGCGCGAACCACTATCGTCGCCCCTGCTGGCGCCCGAGAAGGGTGCAGCAACCGGCACCAGCTC
GCCCGCTGCAGAGCCCGCCGCCGCGGTTGGACAATCGGCTCGAAAAGATACTGCGCGGAGGACATCTGCCCGGCTGACGTGCCGTCCAGCGGCAACCGCG
CAGCGAGTCGACCCCGGAGCGCTCGCCGCCGCTGCCTACCTCAGCCGCCGAGGCTGTAACTTCCCGGCCAACGTGTGGCGTGTTAGATAGCGCTGACGCG
GGTGCAGCCAGCGCTGCTCCGCAGCCCGCCCGGCGTTCAGCAGCACCGTCAATGGGCTCAACGCTTCTTGCAGCCAAGTTGCCGCGCGCCGGCTCTTTCC
CCAGACGCCCGGGACCGGTCTGAAACTCTCTCCCTAAAGTGCGACAGCCTACGCGCCCAGCTGGAATCCGATAAGCCGCGCTCTCCCGCTGCGGTTTGAA
CCGAGCCTCGATTCTCTTCCTGCTCCTGCCCGCCCGCGATTTCACAACGGCCGACGGACCAACCAGCCGAGCCGGAGCTCTGGGCCAGAGCAGAGCACAG
CCTACCCATCATTACATAATCTCTTTTGCCCGCTACGTGTAACGTGCTGCGTCCCGAACACGCAGACACCAGCCCGCACGGACGCCGCAGCACTCACGCC
CACGCCCAAGCTTGGTCGTTGCGAAAGATCCGCTTGACACGCAGCAGTCTCCGTCACTCGTAGCTCTACCCCCTTCCTCCACGCGCGGCAGCTCGATCTC
GCCGCCCGCCCAGGAAAAATTAGTTCGCACTCGCAGAGACCGAGTGCAGCAGCGCCCACCCCCGTCCAGCCGCTCCCGACCAGCACCAGCACGGCCATGT
CCATGGGCCTCCACTCGGCGCGCGAGGAGCTCGGCCTGCCCAACGTGGCCGCCAGCCACGGCATGGCGCTCTCGTCCACCGGCTACATGAGCGGCGACGT
CGGCCAGCAGATCGGCGGCCTGCCCAAGCCCATCAGCCTCAGCCCGCGCACCTTCGGCATGGAGGACCTGCGCGACTTCTGCGGCCCCGTCGGCACGTTC
AAGACCGGCCTGACGCCGCGCGTCTTCAGCACGGGCCTCACCCCGCGCTCGGGCTTCACGCCGCGCTTCACGACCGGGTTCACGCCCCGCATCAACGTCA
ATGGGCTCAGCCAAGCGCCCAACGCCCCGCCCACCGAGACCCAGAGCGCCTTCATGAACCGCCCGGGCGCGGGCTACTCGCCACGTGGTGGCGCGGACGC
CAACAACAACAAGATTTCCCCCTCGGGATTCACCCCCAAGGATGTGTCGGGCGCCAAGGTGCCGATGCGCTTCCCCGGCGCCTTCTCCAACAACAGCCCG
CCCAAGATGCCCATGGGTGACCACCCGTACAAGCAGGAGCCTGCTCCGCCGCAGTCGCACCTCCAGCAAATGCAGCAGATCCACCAACACACCCAGCAG