Description :
From Genome Similarity Track
Location :
Scaffold_5:39873- 41345
Transcript NameFunction/comments
Phyci_264747conserved hypothetical protein

Sequence
1472 bases(100 bases per row)
ATGCTTTCTGTTCGGGCGCTCGGGGCTTCAGCCCTGGCGTACGTTCTCTTGGTTACGCAGCCGTCGCAGGCCGCGGACTACACCGTTAAGACCGATGCCT
CAACGACGCTGATCGGGTCGTGGGAAGGCTGGGGCACGTCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAGGACATCGCCGACCTACTCTTCAC
GCAAAAGGATACCGTGACGCTGAAGGAGGCGTCGTCCGGACTTCCGGCGCTCGGATTCAACATCGCACGCTACAACATTGGCGGTTCGAGTAAGAACGTC
ATCGATGACAGCGGCACCGAAATCGCGATGAAGATGTCGCCGAACATGCCGGCGTTCAAGTTTATTGAATCCTTCTGGTTGGACTGGTCTAGCAATGACA
CGACCAGCAAAAGCTGGAACTGGAACGCCGACGCCAAGCAGCGCAAGATGTTGCAGTTGGCAACGCAGCGTGACGTCGACCTCACAGAGGCGTTTTCGAA
CTCGCCACCATGGTGGATGAACAACAACCATGCCACTGCTGGCGGGGCGAGTGGTACGAAGGACAATTTGCAAACCTGGAACCACGGTCAATTTGCGCTG
TACCTGGCTGCCGTCGTGAAGCAAGCTAAGGAGAGCTGGGGCATTAACTTCAACTATGTCGAGCCGTTCAACGAACCGATGAGCTCATGGTGGCAGTTCC
CCGGTGGCCAAGAAGGTTGTCATTTCGATGTGGCCACGCAGAAGGATGTATTGGTGAAGCTTCGCACGAAGTTGGATTTCTTCGGGCTGAAAGACGTAGC
TATCGCGGCATCGGATGAAAACTCGGATACCCAGGCACTATCAACGCTCAACTCTTTGTCAAGTGATCCCAAAGTGATGACCACTATTGGAAAGGTCAAC
ACGCACGGGTATGGCAATCGTGAGTCGGATCGGGCACCATTGAAGGCACTGGTGAAGAAGGTGAACAAGAAGTTCTGGGACTCCGAGTACGGTGAAAAGG
ACGCGACAGGGCTTAGCTTGGCTGAGGCTGTTGCCATTAACATCAACGAGATGGGCGTGTCTGCATTCGTCTACTGGCAGCCGTTTGACGGCGGAGGCTG
GGGCCTCATCAACTCGGCTCCGGGGAATATGACGATCGGCACGCCCAACCCCAAGTACTACGCACTAGCACAGTACTCCCGTCACATTCGACCCGGCATG
GCCATCCTCTCCACGGATGACAAGAATACTGTCATGGCTTACGATGCCAAATCCAAGCTTCTTGTACTCGCAACGGTAAACGCGGGTGCCGCGGCTTCGA
AGGTCACGTATGACCTGGCGAGTTTTTCCAAGGTGGCGGGCCCGGTTAGTGCGTGGACGACCGAGACAAGCGGTACGGGCGCACTTTACAAAACGTCGAA
GGTCGAGTTGTCGGGCACAACTTTCGGTGTGTCGATTCCGGCCGCATCGGTGATGACGTTCGAGATCCAGGG