Description :
From Genome Similarity Track
Location :
Scaffold_26:398666- 406586
Transcript NameFunction/comments
Physo_133483reverse transcriptase
Physo_133484hypothetical protein

Sequence
7920 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCATTCGTAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGTGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGC
CCACTTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGGGAA
AACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTG
GTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCC
GGTGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCGCTGCC
TCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAG
CAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTC
TGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGC
TGTGGCAAGCTTGGGCATATGAAACGTGCTTGCCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGGTGGCAGAAGC
CGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCAGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCC
ATGGGGACTTAGCCTCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCTCGCGAGTGTACCGGGATACGATCGTCC
CTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGC
AAAGACAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGAGGTAGAAGTACCTCGGGTCCACGTGGACCTCACTGTCAAGTTCGAGGACTTCGACA
GCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAA
GGCCATCGGGGCCAGCCGTCCCCCACGGTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGC
GCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACC
AGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGTTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCC
ACGCGAGGTCGCTCAGACCGTAACTGATGAGGAAGGCAATGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGAT
GCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGC
TCAAGAACAAGGCGGGTAACCATGTTCCGCTCAAGGACAAGGCGGGTAGCCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGA
GAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCC
AGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGC
TTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGT
TTCTTCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGG
CTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATTCACCGTCCAATCTCCCTCCGGAC
AGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCT
TCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCT
GGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTG
TATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGG
AGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCATACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTA
CTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCG
AACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTACTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGG
AGAAGGTGAAAACCATCGCGGCTTGGCCGCCGCCTCGGTCGCAGAAGGACTTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGG
CTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCG
AGCTTACAGCGCGCGCCAGTCCTGGCATTGCTGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATTCGTCTGACTACGCAATTGGCTGTGTGCTATTGC
AGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGACAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGT
CATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACG
CCGCATCTCTCACAGCAGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACG
CGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGTCGATGCCAGTAT
CGAACCTCTTGTGCGGTTCTTGGCCGCTGACTCGGAAGCCAAGGCCGAGTGGCTCACGTCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGAC
GGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACG
CTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCG
TAGGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTC
GACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACGTTGCTCCAGTTCGTG
ACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTT
CACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGATCACCCGCAGACGGATGGCCAGACGGAGCGCGTC
AATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGG
TACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCCCAGGTGCTGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAG
TGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAAC
ATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTG
GGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGT
CCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGAGTCGTCTTAAGAGGTACCATGACCCT
CTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGC
GCGCTGGTCGTAAGACGGCGCGGCGTACATCGAAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGC
TGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACAC
GGCCATGGAGACTGCGAGTTTCTTATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACAGCACCAGGCTGACCGGCACGAGCGGCAGCCTCGCCACCA
AGGCCGACGCCAAGCGCGATCTCGAGGACATACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGTCACCACCTGACTCGGGGCCCCAGCAT
ACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTAAAACGAGTCG
TCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGC
AGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACG
TAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGTTTGCGCTTGCTCACGAGTTGAGC
GAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGAGTTCTTTGAACTCTTGGTCTGAATACCCTTTGCTCTGGACGT
AGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGG
CTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGGGAAGAGTGGCTCTTT
CTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCA
GGCTCGGGCGGGAAGTAGCCCTGCAGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGC
TAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCGGACTCCGAGTCGATGAA
CAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCA
CGCTCACGACCTTGTGCCAGCGCCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGT
CGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGC
GTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGG
ACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGC
TCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTC
CTTGGCCTCGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCGTTGGAGGCATGCTTCCGGTCGAC
GTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGAGCCGAGGCGCCAGAGCTCGCACCGTCGTCGTTGGATTTCGACTTTGCGAGT
GAAATATGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGCCCTGTCA
CTATTACGGGATGGCTACAT