Description :
From Genome Similarity Track
Location :
Scaffold_989:3986- 8922
Sequence
4936 bases(100 bases per row)
CTTCACGGCGGATCTCGTCACTGGGgTTtACCTCTCGAATGATGGCCACCTGTCCGTCGCGATCTTCAGCTGTAATGTCGCCTTCCTCGTTGACGAACAC
TGCATCATGCAACCGGGAAtCTTCGACGATCAGCTCCGCGATCGACTTCGACGTCACGAACGCAATGGCTGCTCATGCCCAATACGCCTTATCGTCGCTT
GGTGCCTCGGGCCCGCCGCGTATCACCTCCTCATCGCCCAAATCACCGGAGACGCTCCTGCCTGGCCGACTTAGGATTGCCTCGGGAGTCGGATACTCAC
GCTTCTCCACTATCGGGGGGTCgTCTGCGGCCATAGTGGCAGCCAGTGCTCGTCGTCGATGGCTCAGGTTCGACTTCATACACAAGCGTACACCACTCGT
GGTACCGTCGTGAGCCGACCGAGACACATCTGGCTAGACGAGGAACTGCCTCGTAACCGAGCCACATTCCCACGACCGTCTGGGCCGATATGAGGGTAGT
CTGACTCGATACGTTGGTGATCTTCACTTGGATCGGCTTCCCTTGAGCATTAAGCTCTACCGTTGGCACCCATGCATCTCCTCTTCGGAGCCACAGCTTC
TTCCGGTTTGGTGGCTTGACCCGTAGATAGATGGAGCTTCCCACCGCGAGGGTAGTGTCGCCTTTCACCCGGATCTGCTCGACCTTCTCACTGTACAGGG
GCTTCCGGCCCTCGAAaCGTACCCTGATCTCGTCAGGCATCAAAGCGACACCTTCAGAGAGATCGAGGCGGATCCCGGCTGGAGTTAGGAAaTCGCAGCC
GAGGATCGCGTCCACGTTACCGAGTTTGCCGACTCATACTTGGCACTCATAGGCTAGTTCATGGGCAAGTGTCACCTTGACCCACGCCTTCCCTTCTGTG
GTGAATGCCGATCCTCCAACACCTTCACAACCTAGCTGCTCTGATCGGTCGACCTTGATGCCCTTCTTACGCGCAAAGTTGGCATCCAGGATCGAGACCT
CCGCGCCTGAGTCCAGTAAGACTCTAGCGTTGTGACcATTCACCTgaGCAGCGACAATCGTCTGGCGATACAGCTTCTGAGAGTAaTATCTCCAATATCC
CCGTTGCTCTCCTGGGTGAAGGATGAGCCTCTGGACCACTGGAGTTCtCTCGAACTCTTGAGACGACAGATCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTAGGTAATCGGTCGTGTTCgCCTTCACCTCAACCTTCGGCGCGATGAAGTCATGGCGAG
CAGGAGGAGTAAACACTTCTGCCTTCACTCCGATCTTCTCAAACTTGTTGCTTGTGTCGGGCTTGAAGACCTTGAACGGCGTCTGAGGCGGTTGCTTAGG
CGATTCCCTACGCACTGGTGTAGACGGTTGTGTCGAGTTTGCCGTAGTCGTCGCACTTAACAGGCGACGATCGGCGTCTCGCTCTTCGACCACATCTTGC
AAGTACCGTTCGAGCCTCTGGATGATCGACTCCTTGAGATCCAGATCGGTCTGGATTCGAGTGATCTCCTCACGTGAGACTCCCATATACTGTTCAGCGA
CCTTCTTCAGCACCGATTTCCATCAGATCACCTTGAGGCTTGACACACATGGCTCGTTCGATCTTCCGCTGCATCTGGTGGCGCAGGGACAAGTCGTACA
CGGCCTGACCAGCCGTGATCAGCTTCTCCAGACCTTGCGCGATCACCAACGACCGATCTGCGATCGTCACCGAGTATCCAGCCGTGTTGAACACGCTGAT
GACGGCCAGTAGCACCTGAGTAGGGTCCTTCATCGCAGCGAATCCTGGGTCGCGGACCTCACTAGGTGGTCCACACTTCGACACCACGAAGTGCTGAAGA
GCCGAGTTCTTCGTGACGAGCAGCTCCAGGGCTTGAGCTGGGATCGCCTGAGGGTCGATCCTCGGCGGAATTGCGTTCATCGCCTTGGTGGCTGGGGTCG
GTGGTGGGTTCGCAGCCACAGTCACCTCCGCTAATGCCGTAGTCAGGTCGGTCAGATCTCCATCCGTTGGGGgCGATCCACGTCGACCTGATGCGGCTTC
TTCGTCCAGATCAGAGAGGAGATTACGGGTAGCACcGTCACCTCCATCCGATCTCATCGCGACCATGTTCACACTTGGGGGTCCTTcGCGATTGGACTGT
TGTTCTTGaTCTCCTGACCCAACTGAGGACccTCCAGATGCGTTGGAGCGTGGCTTCGCTTGCATAaTATCGCTATCaCCTGCAGCCACGTTAACAAGCG
ACTTCGACTTCGATCTTTTCGACTTCGGTGGCATATGATCACCAGATCCTGGCATACGCACCACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCTGCCGATCGTCACAACCCGGGTGATCTATCG
CTTGATCGGCTGATGTACCCGGTTCTGCCGATCTGGAGCGGTCCACAGCTTGTTCTGGGACGCTTCTTGGGCAGATCATGTGGCCCACACATCTTGAGTC
AGGTTGGATCTACCGATCTGGCGGTTGATCGTCTCGGAAACACCTTAAAACCTCAGAAAATGACCCGCTTCACCACAGTTTTGGTTCCAAGACTTCACGA
CCTACAGAAGCTCTGCATGGACATCGACTCCATCGATTGCGATACGATGCAAGGTCACAAGATGTTTCTCCACGTGGTGGATGAGTACAGTCGGTATCGG
TGGGTATTCCTGTTGACAAGGAAAAGCCAAGCAAGCAAACATGTGGCCAAGCTGATACGTCTATTGCACAACAAGTTCCGACACGCGGACCGTAGGGTTG
AAGTCTTGTTCTCGGATCAATGGGGAGAGTTTCTCA