Description :
From Genome Similarity Track
Location :
scaffold_697:3986- 8088
Transcript NameFunction/comments
Pl_102918hypothetical protein PHYSODRAFT_533148
Pl_102919conserved hypothetical protein

Sequence
4102 bases(100 bases per row)
GCTTCACAGACAGACCGTTGAACGCCTCAACCAGCACAGGAATCGACTCGATGTTGTACACATCCATGGCCAGACCGCCGCCAATACCCAACTGGTTCTC
TATAACAATAACACCACCAACGATCAAATGAGCATCACACACTCCTCCAAATATCTTTGCAATAGCATCAACGTACGGCTGTTGCCTCCCCAACTATACA
GCTCTCCCTTGTCCGTCAACGCGAAAGAGAAGTCACGACCAGCAGCGATTGAGACTACATTGTCTTTGGAAAAGAATTCGATCGGCTCCGGCACTTCACA
TGTATCAGACTCGCCATTGCCAAGACGTCCGTACTCGCCGTTGCCCCAGGCCCAAATTTCACCGTCTTTGGTAAGTGCTACTGTATGGAACTCGCCGCAC
TCCACCGTGGCGATAGGTACTCCCTGATCTACGAGTGTCTCGAGCAGACGCGGTGTCGTCTCGTCCTTGCCGCCAGCGTGACCAAGTCCACCCGCGCCTT
TCATAGTAGAACCTCCCCAGCCCCACGAGTACATCTTGCCGTCTGCATCCACCGCAGCCGTGAAATAATCTCCACAAGACACATCCACTATCTCAATTCC
CTTGAGCGCCTCCACCTCCCGCGGGAGCGTCTCCATCTCGCTGCTCTCACCCAACCCCAATTTGCTGTATTCGTTCGAGCCCCAGACGAACAACCTGCCG
TCTTCATCAACTGCATCATAGGTTAATTATTACATTCTACTACTACTACTATAATAATAACAGTATTATAACGTACTAGCAGCACTGTGACTGGCACCGA
ACTCGACGTGGGTGATGCCCTTGCCCTCAAAGGCCTCTAACAACTTGGGCGACAGCTCCTCGTACGCATTGCGGATGCCAGACTTGACTACGGGTCCGTG
GCCCAACTGGCCCAACGTGCCGTTACCCCACGTGTACACTAAAAACATTAGAAATTAGAGTTAGTGATGACAGCAACATTACAATGTAGAGGTAGGCGAT
GTGCATCGTGGCTGACGCACCGCTGGACTGCGTGGCAAACGAGGCGCATTGCAGCGCGTTGCGTGTGGCTAGGAATCTGGCAGTGGCGGCACGACGCCCT
GCAGCGCGAAGAACGCCGAGCAAGACTTGCACCATGAGCTTCCTATGCAGCGGATATGTGTGGCGACGACGCGGATCTACATCAATGAAACACGAATGTT
GGGTGCACCACACTAACCCGCGGGAGAATTTTTGTGTTTACTAGTCCCATCACACATATAGATGTATGCCACATTGATATTTTCCGACGATCCAAAAATG
GCTACACATCCATTTTGACGTTGCTCATGTACTTCAAGAAAACAACATTCGTTACTGCTACATTCCTCCCCATGTGGGTCTGTAAATGGTCTGAAAGTAC
TCGTTCATATTGCTACATACCTACCCAGTGGTTTTAGCAGCATTTACCTGGTCACAATTTATTGGCGTGTTTGTTATTTTAATCTCTTTTTGAACAAACT
TTGTTCAATAGGCAACACGTCCAATCCCTGTTCGGATCCCGCTGGTCACGTTGACCAGGTCGACATTGTAAAATCGTATGGTGCAATAGATTGGGAGAGA
CCCAAGGACTGGTGCACAAAGCTTGCACCCTACACTGTTGTTGTATTCAACAAGTAGACAGTCGAAAATAATACTGGTGATTGGAAGCAGCGCCACGGCT
TTACTAAGAAATCGCAAGGTTCGCCGATATCCACGTCCTGAAAGTCAAGGAGCTTTCCGAAGACGCTCATTGCCATGACTCAGCTACTGAGCCATCTCAT
TTTCCATTTTGCCACAGATGTGTCCGATGTCTCCACTCAAGATGACGAAGGTTGCAGTGATACTCGCCGTTTTCGCAGCGACACTCCATGGATCGGATGT
TGATACATTTGGTAAAGAGGCAATGCCAATGGCACTTACTACTGTGGTCCCTGCTGATAATTTGGAACGTAGCTCCAATACTATCAAGCATCCGAACAAT
TCGTCGCGAGACGATCATGATACTGATGACTGGTTGTCAGAGCGAGGAGTTTTGGAAAATGACAGTGATGATTCTACAGAAAGTGACGATGACTCGCAAG
AATCTAGGTCTAACCTGCCGGCAGTCATGAAAGCGGCATTTAAGCTAGGCAGCGTCCTCAACGCAACCAGCACCATTAAACCAACATTCAACAACTGGGT
TGGTACCGCTCTCGATACTTCTTTCACTGCGGCGTGCTGGCGCAAAGCTCACATTGCGAAGACGTGCCCGCTCGGATACAATCGTAAACTTGGAATGTGC
TGGACGCAGTGTCCATACTCGTATCCTATCGAGTGTGGACTCGAGTGTGTTCGGCAAAATGATGATTGTGCATCTGCGGTTGCGTACAAAGTAGCAGTTG
TGGTCCAAACGGCTCTGGGCATTTCCTCGTGGAGTATATATGGTGATATGACGAAGTGGGCAAAAGGTATTCAAACCGCTGTCAAGTGCACCAAGTATAT
GATTAGCCTTTCCAAGTCGCTGGTCAGGTATACTCGCTTCATTAAGGTTCACGATCCAGAGGCGCCAATCGAAAAGATATTCGCCATTCTGTACCAGATC
GACAACGTTATTATCGATATTCCAGTGACCATTGCTTATTGTATGGGAGGAAAAGTGTCCGATGACGTCAAGTTTGCTGACTATTCACTTACGACGGCTG
AATACATAATACGAGAAATCGTTTACAACGGCGATTTCATTCTTTCGAAATGGAGTGCGTTCAAGAGCTTCATGAAGAACATTACGTTTGGCGGCGTGGT
GAGTACTTTAAACAAGACCGATATCACGTCGTTGAAGTCTGCTCTCAAATCCAATTCCACCTGTGGCTACGACATGAAACGTTTGTTGGATCGTACGTGG
ATGACTGTGGCTGAGTTGCGTCGTCTGAACCCCGACATCTCCGAGGACGACATTCGTGTTATCATGAGCCACTCGAACCTCATGCTGAATGACATCCCTA
TCGCAACAAATAATTGTATGAACGAGCTCATGGTGGGATCGGATGAATATACCGCATATGCCACACGTGATAAGCTTCGGAAAACTTTTGGAGCTATTGT
GGATGATTTGATTAGTTCTGGAACAAGCAACAATGGTACACTTCTTACTGCTGGAGAATATGCATTCAAGATTACTGATAGAGCGATTGCTATCTGGTCT
ATGTGGGATCCATTTTACATTTCTTCAATTGTTTCCGAGTTTTTTCAGCTCATTTGCGGTCCAACTCAATTTATCGGGGAGATTGACGATGGTAATGCTA
AAGAAGCTCTAGGGATGTCGATTATTCAAGACGCATTCAACAATAGTGATGGCATGTGGACGAAAATTGGTGACGGCACCGTAACCATTACCTTCAAGAG
TGTTGATACTGAAGACGTGTCTGTGAATATCAAATCTGGAGGACACAAGATTGCCGAAGTCCCTGTTCCGGCAGGTAAGACAGTCAAATGGATATCGAAT
ACGACGACATTGGGAGGGAAGACGCTGTATTTAGATCGATGGCGTCCGGGTTTCTTGGGACTTCCTGGAACTGGAGGAGGATCGCTATTGTTGTGGATTC
CTCACTCGACTCAGGGTGGTAGCCTCCAGCTTAACGCGACGTTAAATGTAAGTTAAGGCGTGTTTCTTAATACCATCGTGTAGTAATCTAAAACAATAGT
TAAAGGATGGCGTTTATTGTGCATTGGTACAGCTAGAATAGATGCTCGTCGTAGGCAAGCCTGTTAAGTGTGTAGCAATCCCGTCCTGGGAAAACTGAAT
GGTAATACGTACGGTAATGGTACAGCACTGTTTTCGTACGTATCGCAAACGTTGTTGGTAATCAGCGTGCTGGTAATCCAAACTGTGTAGGATTGATTCG
CGTATTCCACTCCTTTTTTTGCATCCTGATAGTCACCACATCATCACAAGTTGTCGGGTGCAGCAGTTTGGTACCTCGGTCCCGTTCCCTTCGACATCTT
TGTTTTCGATAATGCAGACTGAAAATAATAATACGCGTGATAGGAAGCAGCGACTATGTGAGCGCATTACCACAGTCCAATTGATCCCCTCATTCTGGAA
AT