Description :
From Genome Similarity Track
Location :
scaffold_62:39858- 42210
Transcript NameFunction/comments
Pl_110752conserved hypothetical protein
Pl_110753conserved hypothetical protein

Sequence
2352 bases(100 bases per row)
CAAGTCGACAGCACCATGGCACGCGGAGCAGTCGGACGCCCGAAGAAGACGGATGGAGACCACACACGCAAGCCTCGCAAGAAAAAAGACAAGAACGCCC
CCAAGCGCGCGCTGTCGGCCTTCATGTTCTTCAGCAACGACATTCGTGACACGGTGAAGAAGGAGCGACCGGAGCTGCAGTTCCTCGAGATCTCGAGCGA
GATTGGTCGCCGTTGGAAGCAGATCTCCGATGAGGAGCGCAGAGTACGTGCCTACTGTTGCAATGCTGTCTAAATGTGGTTGTCCCTTGCTAACTTGTGG
TTTCTGCTGCCGTCTATAGCCTTACGATGAACTGGCCGCTGCCGACAAGCGGAGATACCTGGAGGAGAAGGAGGACTACGTTCCTGACCCGTCCTTCGAG
TCGACTAAGGGATCCCGCAAGAAAAAGGACCCGAACGCCCCCAAGCGCGCGCTGTCCGCCTACTTCTTCTTCTGCAATGACATTCGCTCGGAGGTGCGTG
AGGAGAACCCTAACAAGAAGATCACTGAGATTGCGACGTTGCTGGCTGAGAAGTGGCGCGCGCTGCCAGACAAGAAGCGCGTCAAGTATCAGAAGATGCA
CGAGGAGGCCAAGGTCAAGTACCAGCAGGAGATGGACGCCTACAACGCTAACGGCACCGTCGAGCAAGAGGAGGAGGACCACGAAGATGAGGACCATGAC
GATGATGATGACGACGACGACGACGACGACGAATAAATTGAAGGTCCGCTGGTCTTCGCGTCAGAGCGAGGGTAAAGACTAGGACTAGTGGTGCGCAGTC
GTGTCACTTTTTCTTTAGCTCGTAGTGCAGGACACACATGGTATCCTTTTTATTCTTTCAAGCTTTTGGTAACGTTCATGTGTTTCTCTTTCATTGGACG
CGTACGTGGTGCCCTTTCAGTAGTCGTGCTTCAACACGTTGTGCACTTGCATTGTGCTGTCGTGATGTAACTACACGGAAGTGCATTGCCTACGTGGTAC
ACTTCCATTGCCCTCACCGATGAGATACATGTCCATGTGTAGTAATACAGGGGTAGCGATGGCTAGATCACCTTGAACGTCCTCCAGATGCGGTACCAGA
TGCTACAAGTTCAAGCACCAAACGGAACGGAACATCGATCACCAGTGTTACGAACAGGCAATTCAAGCGACATGCCCGAGGGCTCACTGGTTGCTCAGTG
AGTCTACACAACGCATGAATCTGTTGCTCTTCTATTGATGTAAATGCAGGCTGACCTAATGACAAGTGTACAATCTTGCCAGTTTAATGGAGCAATGCGT
CGAAGTCCGGGGTCACCACGAGGTGTCGCTCCACGTTGCCCAGGATGCTCATGTGCTTCTCGGTCGTGTTAACTGCGTATATCTCCTCACAGAAGGACGG
AGTCTGGGCCGCCGCTACCTCAAATTGCTTGTCCCCGAGCATTAGCACCATCTTACCCGACTTGTGCACGCAAATCTGTTGGCGGGTCACGGTACACACC
ATGAGAACCTGGGTAAGCAGCGCGATTATGTAGTTTTATCATACCTTGCCAATGAATCCACCCGGCGCCGTCTCAATGGAGTGGTCGAACACTCCATCAT
CCCTGCCACACAAAACCAACCAGCACAGTTAGTATCCTAAAAAATCACTCCCAGCCGTGCATGCACGTACGGTGACTCGTCTGGGTTCTTGGTCTCCTTC
GCCTTCTTGGCCTCCAGTTCTTTCGCCTCATCCGTGCTCTCCATAGATTCGTCTTCATCTGTACTGACGGTCTTTGTAATCACACTAGAAAGAGGCAGCG
TCGTCGGCATTTGAATGAAGAACATCGAGTCATCCGGTGCCACCAGGTCGCCCGATGCGTCACAGAAGACGGCCCCAGCGCTTTCCGGCTCTGGTGGTCG
CACGATCGGCAGACTCATGGGCTCCATGACTGACTTGACCACAGGTGGCCACACCTCTTCCACTTCCATCTCGGGCATTTTTCCTCCAGGCATCTCTTCG
TCGTCCAACACACTGATGCCTGTGCCGCCAGCGGCCGAGTAGTCGGCAGAAGGTGTAGCACGTGGAGCAGGTGTGCCGCTGCCTCCACTATACGAAGATC
CACCCGACAGCGTGCCCACGAAGGCAACCTTGCCACTGGGTAGCATGCCTCGACCGCGACCCCGACCACGACCGCCTCTGCCTCCTCTTCCTCCACGACG
TCCAAAGTCACCACGTCCTCTGTTGTCGCTCTTTAGCGCTCCAGCGCCCGTAGAGTGTGGCTTGGCATCATGAGAGCGCTGTGGGCCAGCGTCAACACCA
TCTCCACGTCCTTCTGGTACTGGCCGGCGCTTGGCAGCCTTCGGCACGAACT