Description :
From Genome Similarity Track
Location :
Scaffold_270:39856- 41825
Transcript NameFunction/comments
g17667.t1hypothetical protein

Sequence
1969 bases(100 bases per row)
TCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCC
ACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACC
TTCTGTGTGAAGAAGGCTACTGGCGGGTGGCGCATCGTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGG
ACATGGTACTGGACTCCATGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCT
CACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCAT
GTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGC
GGCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTG
CTACGTAAGCAAAAACGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTG
GGCCTCGCTAACTACTTGCACAAGTATACGAAGGGATATGCCGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCC
CCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTTCACGTCGTCTGCGA
CGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCCGCGAACGAGTCGTGAGCTATCAATCACGACAGATGAAGCCGGCCGAA
CGCAACTATCCCGTCCACGACAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGAGAACAGACGTTCGCGGTGTACA
CGGATCACGCATCGCTGCGCACAGCGATGAAGTCTCCACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCA
CTACAAGCCCGGCAAGAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACGAGCGACGCGGGGTCGTCAAGTGATTGACGAAGAC
GAGGATGACGAAGATCACTGCGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACCCCAGAAATGTCGCTACGCGAAGAAATCGCCGTTGCGT
ACAACGACGACGCGGTATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAA
CCGATATCAACTCGACGGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATC
ATCCACGAGTTCCACGACAGCCCTGTCGGTGGTCACTTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAAT
GGGTGCGCAAGTGGGTCCGTACTTGTGAGATTTGCCAGCGCGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTGAGGC
GTGGCGCTCAGTGTCGATGGACTTCATCTTCGGGCTTCCACCCGATGCCGAAGGTCGGACTGGCGTCTT