Description :
From Genome Similarity Track
Location :
Scaffold_35:398515- 400781
Transcript NameFunction/comments
Hyaar_Emoy2805156protein kinase
Hyaar_Emoy2805157protein kinase

Sequence
2266 bases(100 bases per row)
CTTTCGAGGTGAGTGGTACGCCTCCGAAACTGCTCGGGGTCAATCCCGGCAGGATCCGTTGTTGTAACAGTGCCGTCAGTGGACAAAAGTGTGCTGTTGT
TCACGTCCAAGTCGCCAATATGTGTACGCAGTCTCCATGAGCTTCTTATCATTTCATCTGCCGTCTGGCACGTATCCAGGTGTGCCAGCAGCACACCGAA
AGCATACATGTCGGATGAGGACCGAGAGGTCTCACCAATGAGAATCTCTGGAGCAAAAAAGGCCTTGGTAGTCGAGTCTGATCGACGGTAGTACGACTGG
CAACTGTAAGGAGATAATCCACCCGTCGGAAGTGCGGCTTGCACGGGGTTCAGTTTGCATCCCTTCTTGGGGTCCACGAGCACACTTCTACCACTGAGTC
CGTCGTAAGTGACCCTATGCTGGCTGTGGATGTACATGAGTCCACGCGCAATTTCAGCTGCTGCTTTCATCTTGAAATTTTTCCAGCTCAGCTTCGAACC
AGAATTCCGGAGATACGCTTCAAGCGTGCCCAGCGTCATGTATTCACACACAGCAGTCATCGCAAGCCGTTCATCCCAGATAAGTCCAGTAATTGAGAGA
AGCTGGGGGTGACGCATCTGTGAAAGCATTGGGATCATCTCTAGAGCTGCCTCTACATCTTCACCACTAGCCTGGAGTTTTGTCACAAGCACCAGTTGTC
GACAATGCTCTGCCAGGGAGACTACCACGGGACCAGAAATCGACAGCTGGTTGAGTATTACCATTTCAGCCGCCAAAAATTCTTTGAATGCTGACTTGCG
GTGTCCACCTCCAGTATTGTACTCGCTCAGCGATGCCTTGAGATCGGTAGGTCGCTGTGGACCGTTAGATACGCCCATTCGCACACGAAAGCGTTCAAAG
TTGACTTTGGTTTTGCCGTCGCCCACCACGAGGGAATCATGTTGCTCCTTCGCTGTCTTTTGCTTCCACCTCCGCAGGAACACAACGCCGCCAATCACGG
CGAAAACACCAAAGAGTGCAAGCCCTAGAACCACAAATATAATGACGGAGCCGCTGACATCATCGCTTGCTGTTGAGGTAGTGCTCACTTCTTCAGAATT
AGCGCTGCTAATGCTGCCAAGGCCGACACTTTCCATTGTGTAACACACGCTTTTGTTGGCCCATGAAACAGCTTCGTAGCCCGACGAGCAGCTTCCATCG
ACGGTCAAATCCGCTTCAAACACTGATAATTTCTGCAAATACTGGAGCTGCGGGAGTGTGATGTGGGCGTTCGCGATGGTATTGCCTTGCAGATATAACG
CCGACAAGTGCCGCATTTCATAAATAACGGGAGGAATATCGGACAGCTCGTTGTTGCAAAGGTCTCTGTACGAAAAAGGTGTTTGAGCCGCGTGAGTATC
GCATCGTCACTGACAAATCAACAAAAGTACAGCATACTAACAAGATAGACACCGATGTCAATGAATGTGGCCCACGAGGATCAAACGCAGTGAGTCGTGC
TCGTTGAATAGTACTACATTCAGACGAAACCCACGCGAGTCAGTCTGAGTCCACGACAGCGAACAAGATGTACAAACAGAAAGAACGCACAGCGACTCGA
GAGAAGCGGGAAAGATATCGGTCAGCATCTCGCCCACGCTAACGTCTGAAATGACACTAGAAATCACGACAGCAGCATTATTATCAGCCAATGGTTTACA
ATGCCAAATAAAACTCGTCTTTTATAGTACACGCACATGTGCTGCAGTGATGTACCAGTGTGGAAAGCATTCGGTGAGAACGAGAGCGGGATCGTGATCT
GCGAGCTCGTAGTCGCACCAACGATTGTCCTAGACATGGCCGAGTCACATCACAGCCATATCGAAAGTCAAATAAGAGTCAAGCAGCTACCAACTGAAAA
AAAGAGCAACAACTCGATCGAGGCCTTTGACGCACAAATTCTGCAATGTCCGGGGCAGCACGAGGTCATCAATGTTCTGGAAAGCGGCAGTGTCCGTCTG
TGGCTGGGCGATCTGCAGCGTCCACTGCGCCTCGTTCCAGCTATTTGGTGTATCCACTAGACACTGCACCTCACACTTGCCCAAGGGCTTTTTCTTCGTC
TTGCACGTTGGGATACTGGCTGAAGCACAGCCCCGATGGAAGTAAGAAGTACTGCCGTCGTTGCTGGATGTGCTTCGGTCCTCTGCAGTCGAAGGAGCGT
AATTCACACAGAGCGATGAGCTACAGACTCCAAAGCACCTGCTCGAGAGCGTATTTTGCTTGGGAG