Description :
From Genome Similarity Track
Location :
Scaffold_1315:3985- 5028
Transcript NameFunction/comments
Phyag_g10257hypothetical protein PHYSODRAFT_509738

Sequence
1043 bases(100 bases per row)
CTTGGGTTGTGCCGTAGCCACGACATGATGCAGTTTTCGTGATAGACGTGAGCACACGGCAGCTTAACCGAGAAAACGTTGGCATTTGAGTCGATAGCGG
GTGATACAGCAGCTTTGCTGTCACTGTTACTGCCACTTCCATTGCAGCCTTCTGGGAGTTCAAACCCCTTCAATTCATCCGAGACCAACGGCTCGAGGCA
AATGCTGCACGAATGTTCCGAGTGGGTAGGGAGTAGttcttcaacatcttcgagGCTCAAGATGGCGTTGGCATACGTACAATTGGCGTCCAGCACACTT
TCAGGCAGCGAGAGGAAGTCGCGCATCAACAGATAGATGCACAACGCCTCGCGGCCCAAAGGTGCTGGGAGATATGACTCTACCACGAGTGCCGGAACAA
TCACCTCCAAGGCTCTCCAGGCATCTGACAGAAATCCCTCGAGCTGGGCCCTCCCTGTTTGCATGGTGTTTGCGTCTGCCTGAATAGAGAAGGCtgtgtg
ctgcagatgctcgTACCGCTGGAACACTTCCGTGAGGATTCGTAAAAACACCTCGAAGGGTTTCCATTCCACGACAACGTCTTGGtcctgttgttggtgc
tggatatCGAACGGGGTGAGGTGTTGTATCACGGTTGGATGGTGCAGAATGGCACCGACTTGAGCGTAAAAGCCACGATACTTGGTCTGGCTCATGGCGA
TGACCCACGCCGATTGTGTCGTGTTGCCGCCgctcgatgtcgtcgagCCGCCGGTTGTCGTCCCCGAGatgcacgtgctggtgatggTCAGCGAGAGCGA
CACCCTGTACACGACCGACATGCCCACGCAGAGTAGACGCGCTTGCACCAgaaagctgaagctggatgGCTGGAACTCCTCGCTCATTTTGCGCAGTCGA
CGTTGCATGGGGGCGCTGTGGGCGTTGACAATTGAGCTATGCATGAGTTTGACGCGTTTGGTCTCGCGCTCGCCTTCCATGATCCGCTTTGACATTTGCA
GAGTGCGCCCGAGCGGGTAGAATGCaaaatgacgacgaagagc