Description :
From Genome Similarity Track
Location :
Scaffold_52:39848- 41362
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16290hypothetical protein
Phypa_INRA-310PPTG_162913-mercaptopyruvate sulfurtransferase

Sequence
1514 bases(100 bases per row)
CCGACTCCGTACCCGTCCACAGTTAATACTGACGCTCCGCCCAGTAACCCAGAGGTGCCAGCAACAACACCTTCAGAATCGGCGGCTAACCCGACCACGC
CGACGCCGCAGCCTACAGTGCCGGACGTTCCACCCCAAACGGACACGCCGTTCCAACCTTCGGATGCACCTACGTCTGCACCGACTACGTCAGCGCCGCA
ACCTGCTCAGCAGCTCAGTACATCAACTGCTACGGCAGGTGAGACTGGTACCGGCGCGACAAGCATGAGTGTTGGTGGTGTTGCTGCTATCGTCGCTGGT
GTCGGAGCTATTGTTGCCATCGCCGGTTTCGCAGCCTACAAGCACCGCCAGAAGCTTGCGTCTCGCAACGAGTTTGAAAGCAGCATCATGACGCCCGTCC
CGAGTCCAGCGTAATGTCCATTGCACGTTGCGTCTTATTCTTTTAATCGCGGTGACAAGAGCTCTACGGTAGTCTAGCCCTGCATACTAAGTATCCAAAA
AAGATACTTTCAGCTTCAACTTGTCTATTATTGTAAATACCCTTTACCGGAGAATTGATGCGCATTCATAATTCTAACTTGCAGTTTGTATTGCTCATTC
TGCAAAATCATGCTCGCACGCTCTTCCCCGCTGCTCCAGACCAGATCGTTGTCCTCACGCCTGATGAGCTCCCTGTCGCCGCTGCTGTCGACGGAGCAGG
CCCAAAGCCTTTCGCAGAGCGGCGAGCGTCGCGTGCGCTTCCTGGACGCGTCCTGGTACCTGGACAAGAGCCGCGATGCCAAGCAGGAATTCACCTCGGA
GCGACTGCCAGGCGCCCAGTTCTTCGACATTGAGCAGATCTCCGACACGACGTCCACTCTGCCGCACATGCTGCCGAAGAGTAAGTTGCTGTATTCTCAT
AGTAACAGATTGAAGCGCTAAAACCTGTGCTAAATTGTAGCGGAGACGTTTGAGCACGCCATGATGTACCTCGGAGTGGAGAATGACGACACGGTTATTG
TCTATGGGGGCAAGCACTGCTTCAGGTTAGAAGTGGATATAATAAAATGTTATTTATTATCTAATAACGACTAACGAGTCGTATGGGGCGCAGCCCGGCG
CGTTGCTGGTGGACGTTCAAGTACTTTGGCCACGACAACGTCCACATCCTTAACGGTGGGCTAACCCTACAATAAACGACAGAGAGTGTGTGTAACTCAT
TTAATTCTCCCATTGTATGTAGGCGGCATCACCAAGTGGAAGAAGGAGAAACGCGAGATCGAGACTGGTGAACCCGAACAGGTGGTGGCTGGAGCGTCTT
ACAAGGCCCAACCCAACGAGAAGCTTGCGGTCTCGTGGGAGGACGTACTGGCCAAGATCGACACGGATACGCAGATCGTTGACGCTCGTGGAGCCCCGCG
ATTCTACGCCAAGGAGCCTGTACGTCGGTATAAAGCTGATTATTTGATTGATGAGAGATCTGACTTGTGCTCGCTGTAGGAACCGCGTCCTGGCATGCGT
GGCGGCCACATCCC