Description :
From Genome Similarity Track
Location :
Scaffold_46:398433- 408950
Transcript NameFunction/comments
Physo_157442hypothetical protein
Physo_136555hypothetical protein
Physo_136556hypothetical protein
Physo_136557CBS domain, putative
Physo_157447hypothetical protein
Physo_136559phosphoribulokinase/uridine kinase-related

Sequence
10517 bases(100 bases per row)
CGGCAAAAGAAGGTCATTGGCGATTGAGACCACAACTTACTGCCGCTCACAAAGAATACAACCGTGGCGGACATAGCGGACACTGCCGCTGGAGTGAAGT
TGACCCCGCGCAACAAGCGCGACGTTGCGCCTTCTCCACCCACGCCGAACGCTCCTCCAACCGCGCCAATGCCTAGTAGGTGGAGAGGCAGCTTCCGGAT
TGACTCAGGTGACCACTGTGCAAACAAAACGGTGGTTAGTTGTTGTTTTTCTGCCTTGGATTGGCAGTAGCATCGTTGCGTGCTTCCTTACCTGGACTTC
ATTCGGAGCGAGGATGAATCGCGGGTTTTGCTGTCGCTGGTATGTGGCCACGACATCCTTCATCTGGTAGTGCGAGACGACCGACAGAAAGATGAAGGGC
AGCATCGACACGAGCAGGAAGAAGAACGAGGTCGGCGGGATTCCGAGAGGGCTGGGGAAGTACTTTCCTCCTTGGAGCGACGTGAGCAGCACAGTGGCGG
CAAAAAGACCAAAGTTCATACCCAGCTTGCGCCATAGAAGGCCAGCCTTGTACAGGAACCCGCCATCGTCGTCCTAGATATCCAGGGGTACATGAAATTG
CATTGGTATCAGCAACATGAATCAGCTCGATTGTCAGTAAATGAGTGCATGCATCGCACCTGAAAGCTTGTGGACGGTGCACCAAGTAGCGACATTGATT
CGCCGCTGCTGCACCACCGCCACCCCTCTTCGTGTCCCACGGCACGAGCCTTCTTAAATGCCTTCTTGCCGATGTACCCCAAGTACACGATGAGCGCAAT
GATAAGCAGCCAAGTAGAGAACCACGAAATCAACGACGCTCCAAAGCCAGCCCCCACTGCACGATAAAACCACACCCACTTAATACGCATGCCAGATGAC
AGACCAGGTCGCACACCGCCCACAAACTTACTGAGTAGCATAGGCTGCATCATCAAGATGAAGTCCCAGTTGATCAGCGAGAAGTTGGAGTTAATCGGCT
TCTTCCAAAGGTTCAACAAGAAGTCACAAACAGCTACAGACAGCACACGTTAGAGCTCTATCGCTGATCGCACACCTTCATCTAGGAGCTTACCTCCGCC
AAAAATGGTGATACTAGCCAGTGGGATAGCCTCCTAAATAGCGAGTGCAATAGGTGAAGTGAGAACTTGTCGGTACCTCCACCAATACAGTCGTGACGTA
CATCTGGGCCGAGCTTCAGCACCAAAATGAAGACGGCGTCTAGAACGGCGCCGCCACCGGTCTTGGCTCCTGAGGCGATTAGCACCACCAGCGCAGCCAG
CACGATGCCAAGCAGCTGATGCGGCCTCTCCACAGAGCGCAGCACTTCCCGCGGCTCGTACGGCGCGTCCTGCGGCGAAAGCGACGGAACGGGCCCGAAC
TTGACGGGGCTTTCTTCCCCTCCAGGAGGCTGTGCAGCCGCCAACGTTGCAGCCAGCACCAGCGCTGCCAAGGCCCCCGCGAGATCTCCCCGACGGCCCA
TCGCGTTCCCCTTCTCTTACTTGAAGCGAATCTAGTTGTGGAGCGGCGGAAAAGTTAGCGAAAACCTGGCATTCTTCACAACAGACAACGACTTACAAAG
CCGGCTTTTGTGTCTGCCGGCTTTGTAAGTCGTTGACTGTATGCAAAAGAGATCTTTGCAGAATTGCAAAGATCTCTGCCGGTTTCCGAGTGCTTTTGCT
GTTCGCCGGCTCGGCTTCCCAAAACAGATCCTTGTTCGGATTCCGAGTGTGTTCCCAGCTCGAAATTTGCACGGGGAACCGTAACATTCACTCGACCAAC
GCCGATTCTCACAGCATAACGCAAATTTCACTCGACCTAGCCGAAACGTCCAGTGAAATTTCAAATTACACAACGAAATCCTAAACGTGACAACAACAAA
CTAATAAAGCTAAAATAGGAGGCAAATATTCACTTTTATCTTCAAATTGTACAACACAAAATGACTTCCCTGATTTTGACTTCCCTGAAGTCACGACAGG
AGCGCCCGGACGCATTCGACGCTCATGGCGACGGCACTGATCAGAACGATCGCGGCCATGGAGAAGACAATTAAGCTTGGACACTGGAATCGGCGAACAA
CCTTTAGCAGACAAATGTGTCCAATGTACGTAGTGAGGAACCCCATGGGCAGCATGAGTCGTGCGAGGTCCAGGTCCAACTTTCCCAACATAAGATAGTT
GAACGACGACACTGGAGAAGACATTGCAGAACAAGTTAGCCCTCAAAGCAGCAGCTAGCAGCAGAGCACAGACAGAAAATAACGCGAGACTTACTTCCAC
TCGAGAAGAGCACGGTCGCCGCAGTCATGGCCGAAGCGGCCGAAGGGTCGACGCCCACCTCAAGCAGCAGCGGCGCATTGATGATGCCTCCGCCGATGCC
AAACATGCCGGAGACTGTTCCAGCTGCGAACGAGAAAACGGGAAAGAACTTGATCGATGACGACGTCCACTGAATTTCGTGGGCTTCAAGCTCATATGCA
GGGCTCTGCTGCTTCTCGTAAACGGCTCCCAAGTTCTTGAGGGAGAAGTAGCCGACACCAACGAGAACCACGTAGGGTAACGCTACGAGCACGGGGTACA
AGGCTGATGATGAATCGAGGCCAATCGGACTGTCAAAGTTTTGCCCTCCGCGGACAAGTCTCATCCCGGCGACGACGACAAATAGACCGAAAAGAGTCGC
GATTTTCCGCCACGGCACATCGGCGCGAAGCTGCGGTTCTCCAGCATGGGCCTTGGTACCGTCGGTTGAAGCGGAATCAACGCCAAGGAGAGATGTCGAC
TCGGGTGAGACGCCACACTGCCACCGCTCTTTTTGACGCGCGCGGATAGCTTTTTGCAAGGTGCGAGTGCCGGTGACACTAAGGACCAGCACCAGCAGCA
CGCAGAGGAGCCACGTGGGCATGAGCGTGTTGAGGACGGTGCCACAGGTCGCTCCCACTGTAAACAACACCAACACGTGAGTACACAGTAAGATATATAA
TTTCCGACCAATAGTGATAACGTACACAGGAGTAGTGGCTGCATCACCAGGATGGCATCCCAGTCGATGAGCGGCTTCTTCGAGTTGTCCCGCGTGCGCC
GCACGTTCATCAAAAAGTTGCCGATTGCTGAGAGGACGAAAATGACGCGAGTGAGCAACTGAGCGAGATCGTTCAACAGGTAAGCACCGAGCACCAACCT
CCGCCAAGAATCGTGATACTGGAAAGAGGGATGGCGGTCTGTAAAACACCACGTCAACCTGAGTCAGCTTTACAGGTAGACCTCCATAACGTCCACGATT
CCTTCGGACGCACCTTCGCGCTGAGTCCGCACACTAGGATGTAAATGGGGTCGAGCACACCTCCCCCGCCAGTGCCCCCTCCGGCGGCAACGAAGATGAC
CAGTGCCGCCAGCGCCATGCCCAACGTCTCGCGCTGCGATAGACTGTCGGCTGGAACAGCATCTTCCTCCACTGGTGATGGCACTGCCGCCGGCTCGCTG
CGCAGCGTGTGCGCGTTCACCGCCGCCAGGGTCAGCACCACCGAGCCCAGCAGAAGGGCGGCGCATGCTCGTGTTGGCAGCCCGAGTCGAAGCTGCATGT
TCTATCGACGAAGCAAATCTTGAAGTGGACAGTGAAGCTGCGCGTCGCGGCAACAGGCAAGCCAACGGGTGCTGCTGCAGCCGAATCCTGCGAGCCTAGT
CAGCGGCGCGCGCGGCCAATCACCACCAGCGGCGGCACCAACGTGTTGTAGCGGAGCCCGTCCTGCGAGAGATAGACACGCCCCATTTGCTGCTTCTTGA
TTGGCTGGGACCGGGCGCGCCGCTTCGGCCTGATAACGCGCCACTTCAACGTTAGAGATTCGCGCAGCTTTGAATTTCGCGCCAACGACGGCATCCAGCA
CCCAGCACCGGAACTCGTCTACCTTTTTGGCATCTTGCAGACTCACAGCTGCATCGAGTATCGTCTCGAGCTACGTAGCCTTGCGCTGTGTGTATTGCGT
CGGGTTCGAGCCGAAAGCTGGTCGCTGCTGACTCGCGGCAGAGTGTTTTGGCCGCATCGAATCCGCGTGCCGGAGACCGCGGCGTCACCAGCAGAGACGA
CGCACATCACCGTGATGCCGTAGAGACCAATTTACTTGCGGAACACGCTAAAGGCAAACCTGGGTCAAGAAGATGGCTGGTATATATTATTTTTCTAGAG
TTTAATGGTTGGGTCGAACTAAGGGTATCACCCCACAAACCTAACGCCTCCACTGAGTGCCATCAGGGGCAACCTACTGGATGGAGCACGGGATAGAAGG
CCCTGCGCGCTCCTCAGTGGCTGCACTGGTCGGGAATGGGACGTCAGCAAACGAGAAGTCGTCTGTGAGCTCCACAGCGAAGCAAACCGCGAGTCTGCCG
TACTTGGCCGAGTTCGTCCAACCAGGGTACTGCGACCGCAGCACGATGGACACGCAGTCGCCCAGCTTGACATGCTGCAACAGCCCTGAGGAACTGCCAA
AATACTTGCGATGGTGGCGGAAGTTCCTGCCGGCGCGGAGATTGGGATAGAACGGCACGCGACTCGTCTCCCTGAGCTCGCCCTCCGCAGTCACGGACGT
CACTGCCACTTCGCACCATGAGCTTGACTCGCGGTACGTTCCGTTGTACTCACGTCCGTCCGTGGCCCACCCCTGGTCCTTCGACACGCAGTCCGCCACC
ACCAGCGAGCACTTGCTCACGTCCACTCCGGGCGGAATCTGCAGCTCCTCAGCCGTCGGCAGCTGCAGCTGCAGATAGTCCTCGTTCATGTCACCGCGGC
CGCGAAGGAGATCTGAGGTCTCGGCCTGGAACGTCAGCAGCACGCCCGCAAACTCGAGAATGTTGTTGATCACGTCCACAGGGAACTGGTGCTGCGCCAC
GACGGACGCGACGTACAGAATCTCGTCGATCGGGCGCGGCTGGATGTTCGAAAGCTCCTCCTCCGGCGTCATCCGATGCACCTCGCTGGCCGTGAAGATG
GCGTCGTCCACGAGGAAGACGCCTTCGTCGGTGCCGCTCGCCACCATGACCGCTTACTTCTCCTGCCTGGTTTGATTTTCTTGTGTGAAGGGTGATTTGC
AGTTTTTTTCTCATTTTGTAAACAAAAGACTAAATTATAGTCCGATTTGTGACAGGTTGAAGTGGCGAATGGCAGTTCCGCACCTGCGCTGAGCAACGTC
GTGAGAAGAATGCAACCACTTCAGCTCTTGCAATTCGCACCATACACTCACGTTATCGGGGCAAAGACAAGAAGGAGCTTTTCGAAAGCATCGCTTTGCT
TTTTAGTAAAAAGTGGTAGGCACGGAACAAGTGAATTGAGCTCTATCACCAATGGTGATTCATAAAACTTGTAGCAATGCAGTTGTTGCAAGTGCAATGC
TTACAGAGGTTCCTCGTGCGTTCAACAGCAAACCGATCCATGTAACGAGCCCATTGTAGCGCGGCTGCCGGCAACTTGCCTTGCCCTCGGAAACCGACCT
CAATTGAACCCCGAACCCCAATTTTTAGTCTTTTGGTCGAACCTTCTTTGAAGGAGGGATTCTGTTCTCAGGTCTCGGTCACAACTGGGCTATCCGATGC
AGCGCGAGAAGGAAGCCCGGAAGCCGCGCCAGCAGCAGCTTGTCTTCTCGACCAAGAAGGCGGGGCGCAAGGCCAAGGCGCGTCAGCAGCAGCAGCAAGA
GCAGCAGCAGCCCCCGCCGTCCGCGGAGCACGCGAAGCCTGCCTCGCAGAGCAGAGACGAGCAGCAGCATGAGACGAGCGCCTCGTCTCTAGAGGGGGCA
CAGGAGCGAGCGCACCGCCGCCCGAGCCGCAGCAGCAGCCACGGCCACAGTCGCTCCGTGAAGCGCATGCGGCCGTCGCGCGCGCTGCTGCAGGGAGACC
ACGCGACGGTGGCGCAGTGCGTGCGTGCTATGGTGGAGCGGAAGACGGACGCCGCGCTGCTCGTGGACAGGAGCGGACTGCTCACGGGCATCCTCACGGA
CAGAGATGTCGCAGTGAAGGTGGTGGCGGTGGGGAGGGACCCCACGCGGACGCTGGCGTACGAGGTCATGACGCCCGACCCGTCGTGCGTGTCGGCCAAT
GCCAGCGCCATCGACGCACTGAAGAAGATGATTTCAGGACAGTTCCGCCACTTGCCAGTGACGGACAATGATAAAGGTGAGAGAATAGCGAGAGTGCAGT
ACAGCAGCGGTGGTGGTGGTGGAGTGTGAGGACTAACGGTGTGAGTTATTGTGCTTTGCGGTAGTGGTGGGGATTCTGGACATCGCCAAGTGTCTGTATG
AAGCCATCGCAAAGCTGGAGCACGCGTACCGAAAATCCTCCGACCGACTGGAAGAGACCGTGAAGAAGGTACGGGAACAATAGGTATGTTGAGGAGGCTT
GCAGTGGCTGATGGAATGAGTTGGTTTGTGTGTGTTATGGTGACTGTAGCTGCAACAGAGCTTGTCTGGCTCGACAGAAGCAAACTTATTCGAGTCCTTG
CGGCAAAAGGTAAGGGCTGAGTATTGGCAACCCTTCGTGTATGGTACCTTTTGTGTTGACATTTTGATGACTATCCTTTTATAGCTCTTTCTACCGACGC
TATCGGCAATCATCATGGAAGGCTCAGAAGTTCCAGTTCTCAGCCCGACGTCGACAGCTATGGACGCAGCACGCATGATGCTTATACAGAAGACCAGTGC
TGTGATGGTGTGCGATGAAGCAGATCGCACTGTCGGCATTTTCACTACAAAGGACTTGATGCGGAGAGTGGTTGCACTGTCGCTGGAGCCCAGTCAATGC
TTGCTTTCTGGCGTGATGACACCGGAGCCTCAGACAGCCACGCTGGGAACGACGATTTTGGAGACGCTCCATTCGATGCACAACGGAAAGTTTCTGCATG
TGCCCGTGTTCGACAGCGGTAAAAAGCTGGTGGGCATTGTGGACGTTCTGCAAGTCACCCACGGTGTTGTCCAGCAAATGGGCACGTTTCAAAGCGTGAA
AAACGACGGAGTACAACCTCTGTGGGACCAGTTCCGCAATAGTCTGAAAAGTGCGAACGATGCCACAGAGCATGATGAAGAAGTCGAAGACGACGGATCC
AACGTCGGTGTGGATGATCCGGATACAGACGATGTGAACATAGCATCGCTAGTGGGGCGCCAAACGTGGAGCGATTTCCAGTCGTCAACTGGAACAAGTG
TTACTGGCGATCCTGCGCTATTGGATGAAAACCCACTGAACGAGCATGCTCCTGACGTGTTTGTGTACAAGCTTGCCGACTGCTATGGCAACAACCATCG
TTTCACGAGTTCTGCCGAGTCATTGGAACAGCTCCTTGTGGATGTCCAGAATCGACTAGGTGACAACACTATCCGCCGAATCCTCTACGTCGACGATGAA
GGCGACCACGTACGTTGGCTGCATTCGACCCATCTCTGAACTTTTGTTATTGAGTTTAACGTTTATTCTGATGGATTGCAGGTGCTACTCTCCGAGGATT
CAGATTTAAAGGATGCTGTTAACCGAGCGCGAACATGGGGCAACAAATACATCCGACTTAAAATCCCCCACTATCGACTCGCGGTGCGCCGCGCATTGGG
ACAGAATGGCGATACGGCAATCGGTATGGTCGTGTACGCCGCTGCTGTAGCTGCACTTGCCGGTGCATCGTTTTTCCTAAGTAGGCGCAAGTGAATAAGC
TACAAGGTTACTTGTTGTGCGTCATGGTGTGTAACTGGCTGGTTGTGAGAGGAAGCGTCACTAGCGCCGGCACTCCTGAACCAGACCTGTCCGAGATAAA
TGAAATGAAATTTTATTATCGAGATACAACAAAATTCGCGGCGCCTTGGAATAAATACCGAGCTGCCACGGCATGGAATGAAAATGATTTGAGGGATCAA
AACCAAGCGAAAACGATATTCTTGACGCAGTCTTCGACGTGATCTACGGGCCCGACGGGAACGGAAATGGTCTTCTCTTCAGGAAGTGATGCGGGAGACC
GCTGCCGAGATATGCATCACGCTGAAGAGCGCCAGCAAAACAATTGACTTCCATGAGAAGAATTGGGGGAAGTAGTAGAACAGCGTCCACAGGCCGTAGA
GGAAGACGCCCGTGAGAACCAGCAGCGAGTTCTGCGGGTTCAACGCCTTGAGGTTGGAGTGGAGAGCTGCTTGCGGATGGGGAGCTGGGGCTGCATGCAA
CCATTACAACACGCACACGAAAGCCATCAATCTCCATATGGTGCAACTTGAATGAAAACAGTTCCGCCGGAACTCACGGGCATCGGTTACGACGCTGTGG
ATGACGCCGTTCTCCTCGATGCCGTATTCCCCCATGGAGCGAGCGGGCAGCAGCAACATGCCCATGTAGATCAGTCGGATCTTCTTGCCGTTGGCAAGTT
CATCCGCGAAGAACTGTAGCAAACCAACCATGCAGAGCTTAGTACCGTAGAACATTTCCAGCAACAAAACTACTACATGATCCCACCTTGTTGACAAAGT
CTTCGACTTGCTGCGTGGCCTTGAACCACGCCGGTCGAATCTTTTCGCCTTGGCGCAGTCGAATGGGCAGGTAGCCCTCGGGCACCTCATGGTCCACAGC
TTCCGCCGTTTCCTCTTGCTCTGGCCCTTCCTCCGGCCTCTGCATCCGACAGAAGACAAGAGCAACGAGTCAGACTAGAAGAACAACACCGCGGCAGCGA
CGGTAGCAGCAGCGCCTTCGTACCGCTTCGGGTGGCGTCGTCACCGACGCGACGACTCTGCGCGTCCAACGTAGCAGAACAGCACACAGGCAACTTCTTA
GTCTCAGAGTGTCGACCACCGAAGAGACTCGCGCTACGGTATGGTACGTACTCTGCCTCATCGTTCACGAGCTCCCACTCGTCGTGCAGCGCGGCAGGAG
AGGAAGGAGCTTGGGCTGACGAGTGCATCACTTTCTGCTGAATGGGAACTATCTCTTCTCTCGGCGCAATTTTTTCTCGTAAATTACAAAATCGTATGTC
GGAACAGGAACAAAAGACTGAGACCATAGACCAAATCACAAAGTTTTGCTCCACTTCAACACGTCCTCTCCAGCTGGCGACGAAGATGGCGTAAGAAGCG
AACAATGTGCCCAGGCTTCAGTTTGGCTAGTTGTACTACGTGATGTTCCTGGAGTTCGCCGAGCGCGTCGACGTCGTCCCAGCCGCTATCAATGAAAAGC
GAAAGTAGAGCAGTCTGTCCGATGCTGTCAAGCGCAGTTTCGAGCACCTTGGCTGCAGTATCTTGGCCATCGTCGACCGCCGGAGTGACGCCGCTATCTT
GGTTTGGCTTGGACGGTGTTGCTTCATCCATTGGCGTCTTCCGTCTTAGCATCGGGAGGCGCATGAGCCACGCTGGATGCGAAGGGATTTTGAGGTTGGC
TTCCACACGAGTGTCATAGACGCACAGGATCAGGAACTGATAGTAAGGCGCATTCAGCGCGATGATCGCGATGCCTGCTGTGATGTTGAAGAGAGCGTAC
TTGAGCGGGAATGCTGCAGGGAACCAGATCATGAATCCAAACGACCCACACCCAACGCCGAGGTAGAAGTAGATAGAAGGAAGAGTGAACCAGAGCTCGA
GCCTTTGCAGTAACCGGGTCGCTTGGTAGTCGTCCTCAGTTTCGTTTACCGCGAGAAGAACGAGCACGCTGTTGATGACGGAGATAGCAAGAAGAACATG
CCCGTGCAGAGGAAGGCACTTGCGATGCCCTTTACGTCTTCCGACCACGACGAACCATAGTTGTCGAACGACGTGGTGGAGACAACCTGAAGCCAGGACG
CCCACACGGTGTACACCAGCGCAGAAATCAAATCCACATTGGTGACCTTTGTAAATGCCTGCTGTCGGGTGTTGTCGTGCTCGTGAGGGTCGAAGCCCAG
CCAGCGAAACGTGTAGGCGTCGTGCATGATCAGCGGGTCGAACACGCGCAGCATCGTCTGGAACAAGCTCCCCGTGGTAGCCTTATCGGCACGGCCAGTG
GCCTGACCCGATACCTCTGCGTTCATCGTCTTCTCACCCGTCGAAAGCTTCCTTGCGCAACATCCCTTTACTGTACGTGCTTCCTCGCCTTGGCTTCTGG
AGGAAATTGGCACGATATCTTAGCTCGGTTAAAACTTTTAACTTAAAAGGTCGCGGTCGAGACGTGCTGATTTACTAACGCGCGCTACATTGCCCAAGCT
TACAGCTCGGCCTGCATCATGCATAGCGGCTTACTTTCGCATCAAAGACAACGCGGCACGTCTCGGCTAGCTTTGCAAGCCGACTCAGACTTGTTTGTTA
CGGCACCTTAGTCGCCAAACCCAGGCACACTTCAATACTTATTACACAAGGGTCAGTATTCATGGAACTATAAATCGAGTAGCAACACCCTTTCGATAAA
GACCCGATCCGATCCTCGTTTTTATGATTCGGATCGCTTTGCAACGTACCTCCTCGCTCAGTCGTCAATCAACCAAGTCAAGCGTACACCCGACAAGAGG
ACCGAGTAGCATGGCAG