Description :
From Genome Similarity Track
Location :
Scaffold_1246:3984- 6426
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1246-snap-gene-0.6Conserved Plasmodium protein
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_1246-abinit-gene-0.14Proline synthetase co-transcribed bacterial protein

Sequence
2442 bases(100 bases per row)
CGATTGATGACACCACGATGGAGCAGTATGCAGACGTACGATACACTGTGCCATAAAGATTTCTAATTGACGCATTGCGGGAGCTGACTGACTGACTGAC
TGATGCGTTTGCATGTGTAGTGGCTGGACAACCTCGAGCGCACGGACCCACAGGCGTACAATCAGCTCATCGCGTCCATGAAGGCGGAGTTGGAGAGCGC
AGGACCTGCGATGCCAAGTATGGACCAGAAGGGCGACGCAGACTCGGCGCTGTTTGAGATGCTCAAAGCCACTGCAAAGACGGGAGCTGGCACTGCCAAT
GGCAAGAGCGACAACGCGACAGGTTCGATTTGCAACCGATGCGCTTTCTGGAAGAGTTTGGACGATTGCTTGAGCACTAAACTGGAGATTGTTTTGCCTA
GACTTCAAGCCGCGCTTTCCAGGCAACAAGGTGATGGAAGCGAGCGGATTGGCTGCCAAACAAGAAGGAGTGAGTGCACTTTCATGTTGTACACACTGCG
GCTTCAGAGCTATATGCAGGAGGTAAGCGCCATGGCCCTGACATTGTTGGGGTGCTATTTGCTGTGAACCTAGGTGTACATTGATGTCCACCCAGGCTTC
GTCATGAAGACAAGTGAACTGAAAAGCGGGAAAAAGGTCACGCATTACACCTTCTCATGGACAATTTTCATCATAATCCCGCTGAGATGAGCCTGACATG
TTTGCGTTCGTGTTATGACGTAGGTGTTTGTGAACGTGTGCTATTCGGACGAGATCCAGACGTTCTCGCAGCAAAAGAAGCTCGACGACGAAGGAAAAGA
GCAGGAGGTAATACACATACCAGTGGATGTGTTGAGAGGATTCACTAGTTGTAAACTAATTAAGATTCTTTCCAACGATTTAGGGGATCCACGTACCATT
GAGTCTCGGCGCACCGCATGAAGTGAAAGACAAGAAAGGCGCCACGTCGTTGGCGTTCGACGTCGCCGTGAACACACAGGTTGTCGAAGACTGCAAGCTT
GATAAAACGGGCTCGTTTCGCAACTTTGTGTGCGAATTAGCGATCGAGTATATTGACCAGAAGGTACATTTTGCGTATATTTGTTGCTGCCATTGTGACG
TCCTACTTGTTTCACTCGGCTCACCGCACGCAACGAATCAATGCTTGTGTGTATATCCTGGGCTCCGCCATGGTCTAGTACAAAGTCAAGCTTGACGCGC
GCTATAAGCTTCCTCGTCTCTCCTATCGAGGCGATTTACCGCCACCTAAGCATTACATTCGGAAAGTAGCGGCGCCAAAGATTCAAGATGTGACCGGCAA
CTCCGCGACAACCTCGACCAAGACAGTGAGGAAGAAACTCGATCAGCCCAGCCCCCCTACGATATCTTCTACGGCGCGCTGGGAACTACATGAAGTGACG
ATGAAGAGCTCCAATGATGAGGAAAGGATACCATGCACACGCATCGCTGCGGTTGAGAAAGACGGGAAGCCGCTCTCGCAGCAAATTCTCCAGCAAGCAG
GAGAGTTTCTGGAAGTGACCATTTGGTTTCAGACTCCCATCGAGTCACCAGAGCAGCTTGAGATCGAGCTTCGTCCAGAGCTGGTTGGCGTTAAATCGTA
TGCTCACCACGATCTAAGTAAGTCGAAGCGAGCAGTTTTTTCTTTTATCTGTATGCAAGCCATCTCATAGTCGCCGTTATTAAATTTTTGTATGTAGGCA
TCTTTCTGCCGTACCCAGTGCAGGTGAACTCCGCTCAAGTCGCCTTGAATTGGGCGAAAAAGAACCTCACGTTAAGATTTTGTGTCGACAAAACGTGGGG
TACGGAGAACCCGGATTGCGGCTCTGCACCGTGGCTGTTGGCTCAAGCACTGCATGGCAACGAAGACGGAACCGAGATTGGGGAGGTGACGAAAAATCGT
GAGGAACAGAAGAAGCCCAAGTCCCTGGCAGAAATGTTTCATCTGGAGCAACCAGATGCTAGAGATGCTCCTCAAGCGAGTGCGATGACAAGCCATGCCA
CAAAATGGGACCCGGTGGACGACGACGAAGAGCTCCCAGAAGATCGTTTCCATCGGAAGGATATGATGTCCATGCACATTTTAGAGCAGCGCAAAGCGGA
GCGCGACCAGAAAGCCAAAGAAGCCAAGACGAAGCGGAAACAGCAACGAGCCGAAGTCGAGGAGAAGCAGCGGAAAGCGAGGGAAGCGGGCAAAACGTGG
CGTGAGATGTATCCGAACGACCCAGAGACGACCTACATCGACATGGAAGACATCTTGGAGCGGCAGAGACAAGAGAAACAAGCCGAACCCAGCGGCGTTT
TTGCTGCTGCAAGTGCGAAAAAAGAATTGGACAAATTACAATTCATGCCAACGGAGGATGCGATCAAGGTTGCTGCGGCGTGGTCGGAGAACAATAAAGA
TGCGAGCTTGGACTTGAGGTCTGCGCTAGCGTTTGAGTTGCT