Description :
From Genome Similarity Track
Location :
Scaffold_1595:39839- 40971
Sequence
1132 bases(100 bases per row)
GAAGCAAGACTCGACTTCGATGAGGAACTGTTGCCGGAGGACAGCTGGGAACCAGATCAAGTTGCCGGTGAGTATGAAGTCGAGGCCATCCTCGACGACA
GAACGCCACTGACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATGAAGATACAACTTGGGAACCATCATCAAACTTGTC
ATGTGGAGGTCTGCTGTACGACTATTTGCGAGCCAAGAAGAGCAAGAATTGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGACTGGATCACG
TGTGAACTGTCCACAGGGCAATGCAGCCTGTGGTAACAGACGAAGAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAGCAACATGAACATGAT
TACGCTGTGGAAGTGGATTGAGAATAAGAAAACATGAATACCGACCGGGGAGCGACCCCTGAAAACGAAGTCACGCGGGACACCTCAACAGTTAGCTGAG
ATGCTGGAGAACGTCGTGGGGCATGCAGCGAAGATTCAAAGCGATTCCAATTGCCTGGCCGCGGTGGCCAAGAGTGCCAACGAAGTCGAGTCACCACTCT
CCTTCTCCTCTTCATCAGGAACCTGAGCCTCGGCAGCTGGAGCTGCAGCCGGACCCTGCGAATCCTCGGCACCAGCTTCAACAGGAGCAGCAGCCAGAGC
GGGACGTGGGGTAACCGGTGGCGAGTCAAACAACGAACGCCAGGTCGGAATAACTTTAGTAGAATCCAGAGACGGGCCAACGAGCACGCTTCGGTACACA
TTCACGAAACGCGTACCACGAGGATTGAAGAGCTCCGGATTACACTGGCACGGGAAGTACGTGGTGTTGTACGGGTGCTGATGCGGCGCATTCATCCATC
CGGTACGCCAAGGCTGACGAGCGGCGAGAGCCGGAACTTCGGAAAGCCAGTCAGATGTCCGAGGTGTGAACGACAAGTTTCAATGGGGTACCACGGCTTC
GACGGCTCCAAAAGCAACTCGGGACGAATGAACGGCGCGCCAGAAGTACCAGAGGAAACCGAGTCACGACTTCACGCCATGTACTGCTCACGGTACTTGT
TATGAAGGGCGATCGTCACGACGGTCGCGCTC