Description :
From Genome Similarity Track
Location :
Scaffold_194:39834- 46820
Transcript NameFunction/comments
g10181.t1hypothetical protein
g10182.t1hypothetical protein
g10183.t1POM57577.1 Hypothetical protein PHPALM_37889 [Phytophthora palmivora var. palmivora

Sequence
6986 bases(100 bases per row)
CCGTCGCGAGACGAGGACGAGCCTATGGAGGCCAACGTTGTCTCCAACAACCTCGACGAAGTCCAAAGCCAGCAACTGGCCGCGATGGAAGAGGCGCCTC
GCGCCCAGCGTCCGATAGCACGGCCTCTGCTCCACCCGAGCCGCCGTGACTACGGCTTTGAGCCACGCGACCCCAACGAAGTGGCTCGCCTCGCGGCGTC
GCAACTGTTGAATGACTATGTCATCGGACCCGCGGCCCATTCCAACGAAGAGGTCGCTCAGCGAGAAGACCTCCGCCAGAGGTTGCTGACGCCTCAGCTT
ACCACTCAACGCGAGTACCGTGAGCGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTGCCGCAAATGCGGACGTATCCAGTGGTCCTTCTGGCTGGCGAAC
GCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGCTGCAAGCTAGCTTCAAGAAGGACGACGT
CCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGCTTCCAGTCCCGCCCTTCGCGGGCTCCTCAACAT
GCTCCTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCTCGCTCCCGGAC
CTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTCGATCGTTTCGATCAAAAGCGTCCACGACGTCAGGGCAGTCT
TGCTGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGGGGTACCCTCGCCACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCA
CAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCTTGATGTCG
CTTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCATCAGGCCGAGAACGCCTATGATCGCTCATGGCACGAGATTGA
TCAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGGTCTCCGACCTTGAGCGAGGTCTGGCGAGGCTGGAGGGTCAAGTT
GACCTTCTGCTGCGACTTCAGCAGGGTTCTGTGGCTGTGCCACCTGTGCACGTCCCGGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGGTCCCGGTACGG
CTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCATGACTTTGAAAGGTCCG
ATGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTTC
AATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTGTCCAAGGACACTCAGACGCGTTGAC
AGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGGTAGCG
TCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAACGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGTGGAAG
CATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCCCTCGGTCTGACCATCGGTCTGTGGATGA
TCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCGG
GCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGGTGTCCAGCACCGCCGCTAGATGAGCCATCTTGCTCAA
ACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCATACTCATGGACTCCCAACACCCAGAGGGTACA
GGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTGG
GCCACCAATACGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTATCGTGTGCCTCATAGAGGATACGATATTTCAG
ATCCTCCTCGTGAGGGACCACAATACGTGGAGTATCCTCCGAATCGGTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTCGCGCGT
AAGCGCGCCGACAGCTTACAGTCCGAGTCTTCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCGCGGA
TCAAGTCCGTCCCGGACGACGTCACAGTCGTGACATGAGATAACTCATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCTT
GTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGA
TCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATAGCAAGTAGCTCCTTGTCATGAACTGGATAGT
TCTTCTCTGCAGCTTTAAGCTGGCGGGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGA
TGCGTCACAGACGACGCTAAACGGACGATCAGGGTCTGGCAACGCTAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGC
TCGGTGTCCCAGGCCCACTCCACATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGA
GGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGAT
GAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAAATTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAA
TGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGA
AGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGC
TGTCAGCGGAATGTCGCTCACACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCGGTGCATCCAACCATGTTGTTCTGGAGA
ACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACAC
AGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGG
CAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTG
GAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTGCGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGT
CCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAATAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGTCTCGCC
GAACTCGGTAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATTA
ACGAGTGTATATAGCTGTTCGCTATCCACCACTCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTC
TCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGTTGCTCCATCGGAGCGTCGACGTC
AAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCCAGGATGCCTC
GGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTTCGCCATCGTGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCGACGCGCATCATCAG
GGCCATGCCCACGATGCCTCGGCTTACTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGC
CGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAG
TGCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCACGTAGCGCCTAAGGTCTTAGACC
TCCAATCAATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATC
GAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACACGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCT
ACCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGTGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCATCCATGGCTTATCAA
AGCCCTTCACGGTCGCTTCAACGGCCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCC
TTGCTGAGGCTCAACAGACCTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAG
CAGGGCTTCGGCTCGCCGGACCCTGGCGCTGCTTACGCAGCGGGCAACCTGGTCGCAGGTGCTGGGTGCTCCCACACACAAAGCACCGGCGGATGCCGAT
GCGCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGTCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTC
GTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGA
ATACTTCCGTTCTGGCCACGCCAGTGCGGAGGCCTTCCATGAAAATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGT
TCGTAACTCTTGGACGAAGTCCACCAGCTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACT
CGCGTCAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCCAGCTTGG
ACACGGCCAGCGCCACGCGCTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTT
GCCCTCAAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCGGATGCCGGATTGGGCGTCGTAGACGCTGTCACAGCCGTCATCTTC
TGTTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTT
CCGGGCCCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTCGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTC
AGGTGTAGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAA
CCTAGGTTCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTT
CAAAACGTGAACTGATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCCGTGGGGTAAATGTATAGCACTCACTATCTACCATAGTGGAGCCTAGTAATAT
GCATGACGGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTGCACACACCAACTTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGAT
ACACTAACGGGTACGTGTAACCCCGTTACACCAAGCGCCGCCCGAACGCATGCAATCTTTTTTTAATGCAGCGATGGAGCGTTTCC