Description :
From Genome Similarity Track
Location :
Scaffold_181:39834- 54580
Transcript NameFunction/comments
Phyta_totarag5182hypothetical protein PHYSODRAFT_358438
Phyta_totarag5183hypothetical protein PHYSODRAFT_309148
Phyta_totarag5184conserved hypothetical protein
Phyta_totarag5185hypothetical protein
Phyta_totarag5186hypothetical protein PHYSODRAFT_466946
Phyta_totarag5187hypothetical protein PHYSODRAFT_343769

Sequence
14746 bases(100 bases per row)
TCGTTGCTATCAATGTTATCCCATAGTGGATGTGTAGGCGGCTTCACTCCAGCACGCACCAGCATTCGCACAGCTGCTTTTTCGATGCGCTGCAACTGTC
GATTCAAGACACTCTCACTCTCTGGTGTAAATTGCTCCGTCCGAATCGTAAGGAGTCCTGCACAACGTCAAACAAAAGTCACTAAGCCGTCCATAACGAT
CTTCAACTAAAATATCTCACCATTGAGATTGCCAAACAGTACGTCCGTCGAGTACCGATCGCCAATCACAACAAGTGTATCTGGATCTACTTCACCGAAG
TGTTTCTTCACGAATGCAATGCCTCCAGGTTTCTGAATTGGCAAACACATCAATTCAGCCGACCTATTCAGAATAAACAAAACACTTATTAAGACCTACC
TTCTGGTTGTGACGAAGCACTGCCACATGCAATCCCTCCTCAATCTTTTTGGCTTCCTCtccgtccttgtcgtccgTAGATCCAGCAGAATTGGAGAAAA
TGACAACGCCCGAGTCACCAAAAACTCGTCGGCACTCAGCCAAAGAAGACTCCAGATGCGGTGCAATTTCCAGTTGATGCGGCACTGTCAACGTATTGTC
CTTGTCGAAGATAACCCCGCAAAACCCATGGTCTCGAAGCTTCTGAAAGGGCACTTCCGTCACatctgaagcagcagagaggGAAGAAAGGTACGAGTGG
GACATTTTTCCAGCAGTATTTTGCAACATTCACTTGTCAAAAAAGGTAAATTATTGCATACATTCAAAGAGGAGACAGAGGAAATTACCTTTCACGGAGA
GTTGcggcagcagaagctgcggctGGCGCGTCAGCACGCGGCAAAACTCCACCACGCCACCGAGGTTGAGGCCTTTCATTCCAATGGCTACGTCAAACGA
AGGCCTcacattctgtccaatccCATCTCTCAATTGACAACAAAAATCATTTATTCGCGAAAACTCTGAAATTattttcgaccaatcaaCGTTCCAAACC
GTTTCGATAGCCAGTGACGAGCTCAGAAATACTCGCTCTCCGTCACCATCAAGACGTTGGAGCAAGTATCGCTCCCTCCTCTCCGCGGCGCCGTGACACC
TTTCCAGTGTCTTGTAccgctgcaccagcaccaggaCATTCCACCCTGCATCACACACCGCTATTCCCGCTTCTTACAGCCTCTAACGCCTTATAATGGC
CGAGAACCCGCAGGAAACGCACATCCAGggcgaagaggaggacaaggCCGAGAACTCGAGCTCTGACGACGAttcgtcgtcctccagctcgggATCCGgc
tcctcttcgtcctcttcttcatctgaTTCTGAGTCGGAAGACGAAGCGGAGACGGAGAACGCCAATGCCAGCGCAGACGCCAACTCCCCAGCCAAACATG
CCGCTCCTCTTGGAGGCGTCAGCAACCGCACAGGCCACGCTTACCCCAACAATAACTCGGGCCCACCATTGTCTGCCCCTCGTCCACATGGAATGGCAGC
TAATACTGAAACGTTGAACGTCAACTCGACgcgagcagcggcgagatTTAAAGCTGCGGAGACGGAATCGATGATGCCCCTTGGTACACGCAAACGAGAC
CGACGCACAATCGAGGAGATCCAGAGAGATCTAAGAGATAAGAGGAAGAAGCCCTTAGGAACACCAGCTGCGAAGTCGAGTCCGCCACCCCCAAAAGGTT
CGCCAGTGCGGTCTCCGGAAGCTGAAGCGGTGGTGAACAGTGGAGCTCCGATGGCTGTGGGTGGACCACTGGGTCAGTTTGGGACTGCGGGACGTCTGCC
GATTAAGAGGAAACCTGTATCGGCGCATGACAGGTTGGCCATGAAACTCAATGGACGCAGAACGACAAGCGCCAAGGCTAAGAAGGCAACCAGTTCGACT
GCTGCAAGTGGAACGATACCGCCAGTGTCGGTTATGACAAACAAAACGGTGACCAAACCGATGACTGCAACGAGTTCGAATGCGGTGACTACaggaaaca
gcagcagcagtgatcATGGAGGTGATGCTGGAGGCGACGGATACAGTAGCAGCGTTAGCAGGTCATCAGCACCGGCTGTGGATGGCAAGGTGGTGCGTGC
GATGCTGCGCGCGATGCTTCGCTATGGAGACCTTACCGATGTGGGTCTCTACCCGACAGCTGTCAATTTTGCTGACGAGTACAAGATGCCCAGCTTTATT
GAGCGATCGAATCTGCAAACAACTACCAAGATCTCCACCGATCGACTGCACACACTTGCAAATGAAGTTGCTCAAAAAGCCAAACAGGCAGTCGAGGCAC
GACCACCGCACGACAACATTAAGATCGCTGAGGTCGAGGCAAGATCAACGCAGATTATTGAGCGCCTCTACGAGAACCTAAAACTCCGCATCGCTATTCA
GCGCGCGTTGCGCACCGCTGGGTGCTCTTCCGGCAACGCACAAGTGAATGCTCAAGGCGCATACGTTTTGGTGGCGAAGCAGAGCGATCTTTCTGTTCTG
GGTGTTAATACACGAGACTTGCCTAGCTGGACCTGGGCTGAAAAGGAGCACGACTGGTCACAACGCAAGgatgcagcgctgctacTTGGCGTCTACGTAC
ACGGTTTTGGAGGTTGGGAAGACATCCTCAACGACGATTTACTTCATTTCCAGGGGCAACGAGCTCTGAAGGGTGAGCGCCTGAAGAAGCGGGCTGAAAA
CCTGCTGAAGCGGTTGCCAGCGCCTGATCTGGACGCTGGCGATCCGCGCATTGTGCAGCAAGCTAGCTCCCTGAGTTCTGCGGGTGCTAACTCGAACCAA
TCGTTAGGGGCACAGTTTAGTGCTATCATCCACAGTGGAGCTATCCCCGGCGTGACAGCATCAATCTCCGCTGTTTCAACTTCTGGAGGGGGTCGAATGG
CACGTGCGGCAGAACGATTCGCTGCCCGGCAACAAAATGGCGAAGATGCTATGGGTCGACGCCATACTGGATCGAGCAACGGTACGGGAACTTCTAATAG
CCACGGAGTGGATGGCGAACGGCAGCTCAAGACACCGGCAATGAGATCTTCTGCGCAAACTAGTGTGGTTGATCGCGAACCCGAAGAAGGCGAAATTGGT
GGTGCATCACCAACTCAATCAACATCGTCGCGGCACAAAAGGCGATCGTCATCAATGGAGGATGAAGACCGGACGTCATCCCGCAAGAAACAccgcaaca
acagcagtgaAAGTTCGAACAAAAAAGAAAGACGAAAGAAAGAGCACCGCAGCGAGCCGAAGACCAATGCGGAGACCCCCGCGGTGGTGGCAAATGTGGT
GGCAGATGTGGCACCGTTGCCGCTACTCTCGCGTGACGAGAGCTATGAGAAGTGGAAACCGAACAAGAAGTTGCGCGAAATCCGTCAGGTGCTCAAAAAA
ATGAAGATAATGGGCGAGTGGTCCCGCAACCAAAAGGACGAGACCGTTGTTGAGAAGGTGTTTAAGTATGTGAGTACAATTGGGGAAGCGATCGATCGCA
TTGTAACGCAGCATCAAGACAAGACCGAACGCCACCATTCAGACGCATCATCTCGCGAGGTTGATGAGCTCTGCACGTCCTTATGGACATATGCCGCGGG
TTTCACGCCATTTACACCGCTGAGCTTCGAGCGTCTCTACGATGACATTTGTGCGGATGCAGACGCTCTCGCCGCAGCGAAGTCATGACGCTCCAAAGAA
AAGTGTGATATCGAAAGGCAGTCCATCCAGGTGCATGTACAGAGAAGAATCGTGGAGAAGATAAGCCTATGAACAAGAACGACTGCATCCAGATTGTGGA
CGACAGAATGTAGCAGCACTCGTCACTTGCGAATACCACCTTGGTTTGCTTGAATGAAACGGTCTCAAGAGGGTTGCCAACTGCTTCGTGACCGTTTGCC
ATGAGGAGTTGCCAACCTCAGGGTGTTGAGTAGTGAAAGAACCGTACTGACAAATGATGTCCGTGTTGCCAGCGTTGCAGCCTCCTCCCAcggcggagga
gctggcgctcaAGGAACAGGTGACACAGGTATTGACAAGTCAAGGTGTGCTAGCCAAGCTAAAGGCAGAACTTCGCGCGGCGGTCTTCGAGGTTATGCAT
GAGCGTGAGGGTTTCGTGAAAAAAAATGTCTCGATGGCACCGAAGCTAAGTGACTTCCCCTTGGGGACTAGGACAACTGCCTTATCGCTGATTGTCGAAT
GCCTGCAGTTTTTCCATTGGGAGCATGCACTGCGTGTGCTTCTTGCGGAGACCAATGCAGAAGATGAACAGCAAGATAGTGCAATGTTGGCTAAGAAGCT
CGGACTGGCAAGCAACAGCTCCTCAAACAAGCCGACACTTTTCCAGCTCATCGAGTCGAGGATACTCGGAGTTGACCAATCTACAGTGTCGGCTAATCCA
CTGGCAACCACCACACACGACCGAttcgacgatgaagacgacgaagaaagccaagcagatgatgcaccagcaccgaagGAAAGTATATGGGAGCGAGAAG
AAATTGCTCGGCCATTGCTGTTAAAAGAGCCCGAGAGTACGGAGAAGGCAACCGAGGATGAAGCTAAGGACGAACAAGGTGAGAGCAGTGCAGATATTGA
AGAGAGCATGGCGGAAGAGGTGCCGAGTGGATCGGAATTGGAGGAATCGAACTTGACAAATtacgaggaggaagagcagaGCCGGGATGGTAGTGCCAAG
AGTAGCAAACAAGCCACCGCCCTCTACTCGACACGACTGCAAGAAGAATCTCAAGGTGATGATGACAAAGCTCAGGAAGATAGTCATGGCAAGGATGATC
ACgaaagcgacgacgatgatgccGTGCCATTGGCAGAACCACCCCCGGCACCCGCAAAACTGCCGGCCTTGCCACCGTTGGTTGGCGCTCCAAATGGCAC
TAGCGCTGGAAACACAGAGGATGATTTCGATGCGGTAAGAACGACAGAATTGATAGCCTTGTTGTGGCATATGCTGCATCGAGCTAACTTATATTTTCTA
TGATGTAGGAGGAGGAAGCCGAGCGGTTGAGGAAGCTAGATGCTGCGTTGCAAGCTATGGAGGCCGAAGATGATACGGGCACACTCCAACAACTGAAAGC
GTCTTTGCAAATGGAACTTCAAGAGCAGGATAGTTTTGTAAGCAGTGGCGGGCTTGGCAaagcggaagaagacgatgatgatgaagaagttgacgctgGA
GCAAGCAAACCTGGTAaaaacgacgaagaagatgaggatgGATATGGATACGGAAGCAGCGActtcgaggaggaagaagaaattgCCAGGTATGAGCATA
TCTTGAGGGTATTCTGCTTGCTCTCTTCTTCCCCCTTTGTGGTACTGAGAATGAAACTTATTGTGCTTTTACAACAGTGAAATTTCcgaggagatggagt
cgATGCCGGAGTTCTCAGACGAGAGCGCAGCAGTCCCGACAACAGAAGTCGAGCCACCTCACATGCTTCGAAATGACACCCGGGTTGAAAACGAAGATGC
GTTGAACAGCTACGACTACATCGAAGACGTTGAGAAGTGAAACGTCTAAAGAATGACTGAGTAAAGCAACCAGAGCTGCAAACACCTCCTTGTTCTCTAT
ccctctacatgtacatatagTCGCTGAGAATCATGTTGGTAGTGCTGACAAAACTTACTTGCGCTTCCCGGCTCCAATAAGCTTGTTCAGCAAGTTCTGG
TCCTTGAAAGCCTCTGGATGGATGAAGTAGTGGCGGCCACGTGCCTGGAACGACACCATGGGGTGCATAGCCTGGGTAGGTGGCGACACCTCGGACAGTC
GGAACGagtgctgctccagctgagCAAACAGAGTCAAAGTCTCAACCGTCACGGTCGGGTCGTCCTTAGTCTCCGCACCCGCAGCAGTAGGCACTGGTGA
ATCATCAGCTGATGAATCCGCCAGCCACATCTTCATTACGTATGGCTTGAATAGGTAGTGGAACAGCGACGTCGACCCAAAACCGAACAACATGATGGTG
CCACACATGGCCCACTACAATAAAGAAACAAAACACAGAAAAAGATCAGCACTCTACCACTCGATAGTCCCCTCAGTGTCATGTGCATTGTTTGCTCACC
TTGCCGACGGCGGATGTGTCCTGCTCGCTCACCACGCAAAGCACAGGCATGCCAATGGACGTGAGGGTGCAGCTGGTGACGGACACAGCCTTCATGAGAC
GCACAGCACGCGACATGGGCGCCTGGTACACTTGATCTCCGACCAAGGCCGTTCCTTGTtgcaacagcttctccacctcccCCCCTTGCGACTTCTGCGC
GTCGTCATCGGATAGAGACGAACTGAAGTGGCGAACAGCACACGGTGGGGTGCGGCGGCTCCTGAAGTCGAATGCGAGTCGTTGAAACGCAGCTGCGTTG
TCAGGGCGACTAGCGACACGGGAGACCGTCCAAAGCGAGCGGACGGAGGCTGGAAGAGTCTCGGTGAGACGCACTGCGCCACGCGATGTGCGCAGGACCA
ACATGGTTGCTGGCGAGCGATCGTGTGGCCACACACGCGacggtataccggtacagtatCGCACTTAGGGGGACAATGAGGTGCCTGCCATTACATATTA
TGTATTTACTCGATGTTGtaaagtacatgtagacgactgaagaaggcgctgcggAGACCCGCCTTGGTCCGGCTacacacgaagaagagagcgGAGCCAC
CCGACCTGATGCGTCCACCATCGGTAGCAGACACGTTCTGGCGCCGTATTAGCCGTCGACATCAGTTGTGCTCCGTTGTGTACACCCGCAGCGCTTGCAT
TGAAGCGTTGGCTCCACTGGTCGCATCGTGCCTCGCTTCATGGCGATCTGTGGACAGTTTACTGACGCCTCGTATCAAAGGAGTAgacgccaccagcgcg
gTACTGGCCCGGATGTCCGCACTCGATGCAATCGCGATTTGTAAGGTGAGCCATCATGCTGACAGCGCTTGACAAGTACTGTAGGATACAGTAAATGGCG
TTTGTCAGCCATACACGACGTATTACACCCTCGATTCGTTCTTACAGTACAAGACCGATTAGATTTACTTTCCGATCCGGACTTGTGTGACGACCAATTG
AAGTTTACTTGAACGGGGTTCGCTGCCACCGCTTTATGCGCCCGCCTCGTCTCTAGCGAACGTTATGTGGCAACAGCCGCCATCTGCTGTTTACTGCAAC
CAAAGGTCGCAATGTGCAACTGGGCGGCTGGGCAAAGATTGCTCCACTCCTCGGTACCTGCTGTCCTCGTAGTTGCATGAAGCTTGACTTTTACAATAGA
TTGCAGGCAGAAACCACAGTTGCTCTGGGAAGAAGGACACGGGGAAGCAATCTTTTTGGCGCCACCGATCCTACCGCATCCGGCCCGATCCCGTTCGCTT
CGATATTTTTTTCGTGTCCACAGCCCGAATGTATCAGCAATGGCTTAGTCTTCTCACTTGTTTTCTTTGCTGGACTTAATCGACCACCGCCTGCAATTCT
CGCCTACACGCGGCATAAATCCGTGCTCCACGCGCTAAACACTCCGAGTTTCAGGGGGGTCATCTTACTTCCTGACAGGCCGACCGCACCAACATTTgcc
gtgctgcagcctcttTTTGCCTTCAATCCCTCCACACGTTCCATGTTGAAACTACGAACGCGGTTTTTGTCCAATTGACGGCGAGAAGAACGATACCCAC
AGCAAGACCAACAATTGAGCCCAGCCGTCCACAGTTTCCACCCATTGCCTCATCCCCCGCCCGTCGGGCGCAGTGAAAACACTCGCTCTCGGTCCGTCAA
GGCGTTTGAGCCGCACTTTTCTCGCGGCTCGCTCGCTCCCTTCGGAGAGAACGCTACCCTCGGAGGCGCCACTTTCCCGCCAGTCAGTCGTGCCGATCCC
GCCAGCCAGCAGATCCCTTGAAGCCACAGACAGTGCTGAACCGACAACCAGGAACCACCGACTCAATGAGCGGCGGCGCGCCTCGGCGCTCGCTGACGAA
CTCGTTCACAGCCCAGGCGGCCCCCAACCACttgcaacaacagcaacagcagcagcagccgtcgaACTATTTGCAGTACCCGATGCACATGGATTCCTCT
ATTCGAAGctacagccagcagcagccgacgcagcagcagatgccatCAGGGCGCTATTGGCAGGCTCCAGCGGGGATTGACACTTCGAGTTATGGGAAAC
AGGGACGCCACGGCGGCAGCTTGGACTTGGGGGAGTTCGTTGACATTCTGGacaccagctcgtccagaGGCGGCAACGACGGAGCGACAGCTGCAGGGCC
CTCGTCGGAAGTAGCGTCGGAGATGAGTATGACTAGCTTCGACGTCAACTCGTTCCACGGCGGGGTGACGGGATCGGCAGGGGGCTCCGTAGGGGATGCT
GGTGGGTTCCACCCAAGTGtagcgacggcgacggatTCGATGCATTCGGGGCCTCAAGCGACGGCAGTGGAACCAACGAAGACTCATTTTACGACGAACA
GGAAAGCAGCTGCGGCTACTGCAGCTTTGGCCGATTCAACGACCAGCGCCTTGGTGGATGCCGCGTACACACAATTCAGCGAGTCGGCCAACGAGCCCAA
CCTGAAGACGGAAACAATTGCCAAAGACAGGAAAGAGAGATGCCAGTTCCCTGACTGCCCTAACCGGGCACGAGTTTCCCAAACCTACGGCAAGTTCTGC
AATCGGCACGTTATCGTCGCGCCCTGTGGTTTTCCTGGGTGTCGGGACAAAGCTATGGAGCGAGCTGCGATGTGTGTAAAGCATATGGAGCTGGGCAAGG
AGGCACTGCAAAAAATCTTGGATGCTCGCACACAAAACGTGCCCGTATGCCGAACGTCTGGGTGTTTTAAGAACGATCAAGGCAAGGGATACTGCCGCGG
CCACGAGAAATTGCTGATGGCCACCGGACGCCTGCCCGCGCACATCAACAAGCGCCGCCTCAACAGTGCGTACACCATGTGCAGCTATCCCGAGTGTACA
AAGCATTCCCAGCGGCATCACTTGTGCCGAACCCACGGAAATCTTATCATAACGCAAGCCCAGGAGTTGGCGGATCGACCTGGAGCCACTGAAAGTTACG
AAGAAATTTTAGCCAGGATGCAGAAGGATATACGTCGTTGCACGCACGAAAACTGCACGAAAAACTCCCAACGAGATCGACTGTGCACCACACACTATTA
CGAGAAGCATAATCTGCTAAAGGACGGCTCGACTCCgacaaatgctgctgcgggtgTAGTAGTGGCATCTAAAGAAAAATTTGGATCAAGTCAGCAAGAG
GCTACTGGTGGAAACGATGTACGAGCTGTTGAACGGACTCGGTGCGGAAAACCTGGCTGCGGAAATCTCTCGTATGCTCGGAGGTTGTGCGTGGAGCATA
CAAAGGAAGTCCAGAACCTGATTCCGAGTCAAGGACGTTATTGCGACCCGTTCTCGCCTGGAGGAACCACAGGAATTTTGGCGGCCGATGTTGAAAGTGA
AGAAAAACAAGCGTTGTTTACTGTGCACGGCCAATCACAAGCTACCGGTGTTTCGATGAATACTGCCAGCACCAAGTGCACTAACCCAATGTGCGATCGC
GAAAGCTACGGGCATGACTACTGCGATGCGTGTCAAAACCTGTTTTCACCTCTTGTGGTATCCATGCATGAAAACCCGGCTGCTTCATCTGGATATCCGT
TCAAGATTGCAAGTGGTGGCATCGCGCAACCTGAAGAAAAGATTTTGCTTTGTCGCGTAGCAAATTGTGGGCAAGAATCCATTCACGGTGGGCTGTGCGC
GGCGCATTTTCAAGCCTTCGAGATGGGGTCATTGTCAGTGGATCAGGTAAAGCTGAACTCACAGGCGCAACAGCGTGAGTGGGAGttggcagaagcagca
gcggccgtcgctgctgcggcagAAACTAAGCAAGCAAACCCTTCAGCATCCGGCAAGGCGAGGAAATATTACTGCAAAGTTGATGGGTGTGGCAAACAGG
CTCAGAAGCGGAACTTGTGCAAGCGTCACTATCGCCTGCACGAGGGCGTTCCTGCCGGAAAATCACAGCCAGAAGTCGAAGCCAGCGTTTCCTCAAGCAA
TTTCATAATTGGGGCACAACAAACTGGATTCGCTCAACCAACCATAGCGTGTCGTTTTCCTGGGTGTTCGCAACTCGCTAGCAGCGGCACATTATTGTGC
TTGATGCACTCCAAAGCGACTTTTTGCTGGCAGCCAGGGTGTGAAAACCTCGTGGATCACCACCAATTCTGCGAATTCCATGCGTTTCGGAAGCAGTGTG
CCTACGAAGGTTGTATGCACAGCGCAGAACAAAATGACAGCGGTTGCAAGCACCACGCGAAGGCACGGAGGTGTCGCCATGAATATTGCGATAAGTTTGC
CGTGGGGTCGGACAACGCCTGGTGCCGCTTGCACCAGATAAGCTGCCAGGAATCTCCGTGTGCGCTGTGCAGACTGCACGCGCTGTCTCTGGATGGGTTC
GCAGTGAGCGAAGACGAGAATAGCAATCGGAGTCGATACAACGCGAATCTGGCTGCCTCGACGTCGAAGGGCATGCCTGGGGGCGGCTTTGGCGGTGGGA
ACCCGTTTGGCCGCAACCCGCGGCTGATGTAGACCGCAGTTGTGACGATTGTATGTTGTGGCGATTGTGGAGTCCAGGTTGGACAGCACGATGTTGCACG
GTAAGAATAAAACTCGAGGATGGTAGGAAAGGGTGAAGTGTTGCAGGCGATATAATCGTTCAAAGGTTCATGCGTAGGATTGGAATTTATGACCGTCgag
ttgtacatgtaggaaaTGTAGGAGGCGGGTGGATGTATTCATGTAATTCAGCCGGTATGTTCGCAAACGATTGAGATGATGTGCCCATGCTCACCTCACC
GCTCGTGCACGACAATAATCCATCAAGATTTGCAAAAAGAGGACACTGGCATAAAATTTCAGTTAGAAACCGGTATTATCCGTTTTCATGAGTTCTCTTC
GAGCTTCAACTCGTCACCAGTCGacgcagtcgtcgtcgtcatcgtctccGTCATCGTCTCCGTCATCGGATCCCCCCAGCACTAATAGAAGACcgcagca
gcgatggagcGCATCTActcggccttcttcacgtcggaGCGGCGTCGCGAGCCACTGGAACTCACGGccgcggcgctggagctgcacaaCGAGACGCAGA
AGACACAGAAGCAGCCGCCGCTTCTGCGCCCTGGAGACGGAGGCAGACGACGGCCCGACGCTGACAACGTACAGGAGGAATCCCTCAATGAGGCCAAGCG
CCACGCGGCCGCCAGAcgccaggagctgcgcaagatgaCGATGGACTGGGTGAGCGTCAAGAAAGATCTGGAGGCGGCTTGTCAAGCGGCGGCGAGAGCT
TTTGTATTGGCTTACGGAGCCAAAGCTTTTactgcagtgctgctggcttcgAGGAAGTGGAGCAGTCTGGAGTATGGCTATGCTGACGCTGCGAGGCTCC
TGTTGAGGGGAGATACGCTCCGTTTTGGAGCTTTTTTCGGGAGTTTAGTGGGGATCTTCAGAGTCACAGAACTTTTGACACGAGCCGCTCGAGGCGGACA
AAGAGATGCTGTCAATTTGGCTATTGCTGGGGCGGTATCCGGCTCGGCGTTGCTACTGGATTCGCCGTCGAGGCGCAATACCATCTCACTGTACATTTTT
GTACGCATGCTGGATGTGGTGTGCCGCCACTTGATGTCCATTGGTGTCTTGCCGACGTGGCGATACTCGTCGGAGATGCTCTTTGCGATGAGCAATGCTG
CTATCATGTATGCATTTGTGGTGGATCCGAGTCTGTTGCCAAAGGTACCCTGATCGGATGGATGTCGCTGTTGAAATAGCTGTTAGCTGTCATTTTACTG
ACATtacagtttttttttcatgaATTGCTTCGTTTTGTCAGGGTTACTACCAGTGGATTTGTCGAATCGGCGCAGTGAACCACCATGGCTTGGAATACAC
TGTGCGTCAGCGTATGCGTGGTCAGCTAGACGCGCATGGAAACCCGTTGTCATTTCGCCTGTGTCAGCCACACTATCACATGTACGCGCGCTACTCTTAA
ATGTGGTTGAGTTTCATAACGCTGAGCGTGACATATTTTGTTAATGGCTTGGTTAGGGAGTCATGCGTGACGCACGCCATCAAGGAATGGATCAACGGGT
TGGGGAGATCAATGCAAATTTACCTCCCTGTGCACTTCCTTCCCGCTATGTTCTTtcgcttccagcagcttcagggGGCCCCAGTGTCTACAACTGCGCG
AATCTCCTACGCAGCGCTCTGCTCTTCAGCGTTTCTCACGTCGTACCAGGTTCGTGTGTTCTATGACTCGATTAGTAGGCGTCACGCTAATAATAATGTG
TTTGTTGTTCAGACGGTGGTAAAACTAGTCATTTGCACGGCTCGCAATGCTTTCCACCGAGACTTTGCCGCAGCAtcgctggctgctggagtgAGTCAAA
TTCTATTCGGTTATGGCATAGTTCAATCCTGCTTTTTTAACGCAACAATTATCTTCATGTACTGATTAGGTTGCAACGGGTGGCGCTCTGTTCTTCGAGC
ATACCAAGCGCCGCTTTGAGCTCATGTTGTATTGCTTTCCACGCGCACTTGACATTGTGTGGCAACTTTTGAAGCGCCGCGGTATCGTGCGCTATGTGAA
GCACAGTGAAGTAGTGCTGTTCTGCATCTCTATGTCGCTCATCATGTCAAGTCCGGCGCGTTATTTCAAGCCGACATACCTCCGGATTCTGCGGTTCATT
TTTGGAGGCGACATTATTTGAGATCGTCGTTGGTTAGAGGATTCACACAAAAACCGTATTCCTTCAACTTAACACAACTCTCGTGACGATATAAAGCAAA
TATCCACACGACATTGAAGCACTCGAAGAGCTACAGGCACGCCAAATTGTATGGCTGTTTATTCACTCATCATTCGAATTTCATTTGAACATACTTCGCG
CTAAGCCTCGCCTACTTTTAGTACTCCAAGTCGTTGAGCACAAACAAATCAAGCATttgcttggcctcctcggGCTTCTTCATAGGAACGAGGTGGCCCG
CTCCTTTTACGGTCACATACGTGATCCCCTTGAACATCTCCACAAAGCCACCCGTTTGCTTCGAGTCTCCCTCAGTGTAAGTCCAGGCCGAACGTGGTGC
CAGGCGGGGAAGAGCCAGCGACTCCACCGCCCATAGTCCACCAAGAGCATTGCAAACTAAGTCTGCGTCACCGTGATAAATCACGCCCTTCACTCCGCTC
TCAAGCAATTGGCGCCACAAGGGCGTCACTTCAGAACTGAGAGTAGGTGTGTACTTCAACATCTGTGGGTGCTGCAACATCGGGTGATCGACACCAAGAA
CAGCGCTCAGCGCATCCATGGAGGCCGTGGTGAGTGCGTCACCACTCCAGTGTGCGAGTGCTGGGTTAGCGTGCATCGCGTCACGGACCTCGGCCAAGTT
AAAGTATGTCTCAATGTGCTTCGTTTCGAGGCACAAGTCCATTGTGTTACCAATGGGGTGCGGGAGTTTACCGGGGGTCGACGGCGTCAAGATCTCCTTC
ACAAGGCGTTGAATATCCTCTTTTGGTGAGCCGGCGCACGAGCCGTACACATCGTACATGTTGATGTGGTTATAGACCAACGTCGTGAACACGTCTAACG
TGGTTGACGTGCACTCCGAGCTGAGCTTACCGTTGCTGCTAAGACCTGGTGCGGCGATGGGGCTCTTTTCGAACTCGTGGAGGTCAGGGCAGTTGGCTTG
GAACTTCTTGTACGTTTCCGTGCTCAAAAGTCCGTGATAGTACGCGAACATGACGGTCGCCAATCCCGAGTACTCGTTCACACCGTTGCCCACCACGAAT
TTCTTCAAGTTGATATGTTGCGACTGCTGTGCAGTAGCCGCGTTCCCTTTCAGAAtggccagcgccgtcgtgggTACATAAATTCCGCCATAGCTCTCTC
CAGAAACGACAAAGTCATTCTCCCTCAGCCACGGGAATTTCCCAAAGaacttctgcagcgcgtcgtACAGATCCTCTGCCTGTGAAAGATCGTCAGCTTC
GTACACCCCGCTGGAGTTGTAGCTGAACCCGACGCCCACAGGGGACTCCACACACAGCAGATTGGCCCTCTGGTTCCACGCGAACTTGTTCACTCGAAGC
GTTTTCCCGTTCTCATTGACCAGTAGTGGCCCGTTTTCCGAGAAGCAACCAGAGAGGGAACTGGATCCCGGTCCTCCGTTGAGCCAGAGCAACACCGGGT
CCGTCTGGGGCGTGGAGCTCTGGGACTCGGCCAAGAAATAGAAGGCGTGCCCCCCATTATTCAGCGGCAAGTAACCTGAGAAGAGCCGCGCCGTGTAGTC
GCTGGGCTTGCCAGCAAGTGCCAGGATCTCGTCTGCGAAGCCTGGGAAGACCTCGCTCGGCAGCCCCGGCGACTCCGCGTCGGCCGAGTCCTCCATGACG
GTGGGCTCGGCTGTGCGTTCGCCCGTGCGGATTAGGTTCTCCgtctgcagcgagcgctggaGCGTCACCATGAGGTCTCCCACAGCCAGGAACAAGAGGC
AAGCGACGCCGTAGCGGATGAAGCGGCGGCCCGTGGTGGACAGCAGGCGGCGCGAGTGCCCCGCGGCCGGCGACGTCTGGCGGGAGCGCAGCCCGCGCGT
GAGCGGCAGCGTCTCGTTCAACGGGTCCGAGCTTGGGTACATGGCA