Description :
From Genome Similarity Track
Location :
Scaffold_245:39820- 42240
Sequence
2420 bases(100 bases per row)
ACGACCCACCCTCGGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACCAAGTACTGTGTCACACGACAGTGGCCCTTGCC
CAAGGAGAAATGTGATATCATTGATGACTTCTTCGGTGCCAAGCACGAGGCAGAAATGGTACGTGAGAGTAAATCTCCACATTCGACACCGACATTTTGT
GGCAAAAAGTCGAGCGGCAAGTGGCATATTGCACATGCTTACAACAAGCTTAAAGCGGCTACTATTCCGGCACAGACACCCATTCCTAGAAAGGACGTTC
TTCAAAACAAAATGGTTGGTTGTACTAAGTATAGCGCACTCGACTTGGTCGATGGATATTATCAATTGCTCATGCGAGTGAGTGATACACCGCGTACAGC
AGTGATCACTCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAGGGGATGTCTAATGCTTCTGCAACATTTAATCGACTGGTGACGCAACTTTTC
TGTCCACATCGGGATTCCGCACGGACGTACTTCGATGACATTTTTGTCTATAGTCGTGCCGAACAAGGTCGGTCAAATGTTGACACCATGCTGACGCATT
TCGGGCAATCAAAGAGAGTCTCCCCCATGCTCCCATTTTGGCGTTTCCAAATCCTGAGTACCATTTTAGTGTTGTCTGCGATGCATCAGATTTTGCTATA
GGTAGCGTCCTGTTACAAACAGATGCTGCAGGCCGCGAGCGAGTTATCGCATTTGAATCTCGCCAGCTGAAAGCTGATGAAAAGAACTATCCGGTTCATG
ACAAAGATCTACTTGCTATGACGTATGCGGTCGTCAAATTAAGAGTCCATCTGCTTGGCTCCAATCCATTCGTCATCTATACAGATCATGCGTCATTACG
CACGGCGACACAGTCGCCTCACCTCTCTTAGAGAAGGCTCGGTGGCTTTTCTTCGTTGCGGAATATAACTTCGAGGTGAAGTATAAGACAGGCAAACGAA
ATGTGTTGAATAAGGCCCTCTCTCGCCGTCCTGGTTATGAGCTTGCTCATGTCACGACTTTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCATATCG
ATGGGATTCTCAATCTGTGGCATTGTTTCATGCCGTTAGTAGTGAGGAACATAAGTACTTGGACACTCAATTATAGGCGCGCTTGCGTGCCAGCCTACAT
CGATATTACATCGATTGTGGCCTCTTGTGGTATCGCACGGATGCTCCTCGCATCGTCGTGTCTCACGATAAGGACTTAAAGTACCGAATCCTCTTTAAGG
CACAATTATACTGCCCTCGGTGGGCATTTGATCCAAGAATGCTCACCGAGGGCATGATAATGTGCATTAAAGAGTATTCGGTACTTATGACTCTGTGAGT
CAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCGTACATTTGAAACAGGCCAGCGGGTAAAAATATTGGCACATTCGGCTGCGC
CGCTCGCTAGTTTGCTTGTTCCCACGGGGTGTTCGGAGTCCATCAGCATGTATTTTGTGTTTGTTCTTCCCAAAGACTGTGACGTCAATACGGGAATTGT
GATCTTTGTTGACCGTTTAAGTAAGATGGATCACTTAGTGGCGGTGCTGGGCTCCATCGATGGTAAAGGTACAGGTATGCTGTTTATCAATCGTGTGTTT
CGTCAACACGGGTTGACACTGGTAATCATCTCTGATCGCGACCCTCGCTTCACTGGCAACTTTTGGACCTCCATCTTCAAGGTGCTTAGCACACGATTGG
AAATGTCTACAGCGGACCATCCGCACACTCATGGCCAGACTGAGAGAGTTAAACGCGTCATTGGCGACGTTTTTCGCAGTGTTTGTGCTGAGTCGCCTAA
GACGTGGAGCTCAATGCTCCCCGTCATTGAGTTTGCGTTGAGAAACGGTGTTCATGCCTCTACCGGGTTTACTCCCTTCTATGTGAATAGCCTCACGCAC
CCCCGTGTTCCACTCACGTTACCAGTACGTGGTTATGAGCTTGGAGGGGGAGAGCATGCTGACAAGATTGCTCAAATCAGCCCTACCACGATGCAGAAAC
AAAGGAGCGAATTTCTCGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAAAGAACAAGCTGATGCTAT
GCAGAGGATGTATTGATTCTGATGAAGTTAGAGACCAAGCCTTATTAAATGCTAAAAACCTACCTACAAATGTAGTGTCTACCGTCTTCAAGACGAAATT
GCGCCCGCGCTTCGTTGGGCCGTTTAAGGTCATAGCGAAGAGAGGCATTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCACACACCCAGTGTTTTAC
GTTGGCTTTTTTAAGCCATA