Description :
From Genome Similarity Track
Location :
Scaffold_769:3982- 9438
Sequence
5456 bases(100 bases per row)
CTACCTATAAATATACTCAGTTCACAACCTACCTCAAGTTGGTCACTTCGCTCCCTTTAGGTAAGAGGGACCTGTGAGCTGCCGTTCACTGAAAGTTTGT
AAACTCTCGAAAGCCAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCATTCGTAGGCAATCCACACCAACGCTGGTAGACTATC
TGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGCTCGGAAGATGGCAGGCATCTTCGGGA
TGGAGGCCCTGCAGCGCCTGGTGGCGTCAACACCGGCCGAGCAGCTCGAGCGGGTCAATGCGTTTGACGCTTACTAGCAGGGGCTCATCGAACATGTGCG
GGAGAGCCTGCAGGCTCCGGCGGCGGAGACAACTCCGCCACACCCGAAGCCAATACGACTGAAGGTTAAGCCGTATGATGGGAAGGAAAGTGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTG
CTAAGCGTTGGGTGTACACGCGGGAGGCAACATCCCCTGGATGTTTCACATCCTGGGCTCACCTGTGCGAACAGCTCCGAGTCGCGTTCCTCCCGGCGAG
CTACGAGTATTGCCAGCGCTCGCGCTTCCTCTCGTGCAAGCAAGGGAGCCGTGAGCTGCACGAGTACGTCCAAGCGATACGGAGCTCACGGCGCTCCTAG
TGAGAACCCCACTCAGCGAACACATCATGATGACTGTGTTCATGGACGGCCTCCGAGTGGGCCCAGCGCGCACTCAGCTATTCCGGGTGCAGTCAAGCAC
CCTTGAAGAGGCGATTGAAGTGGCTCTTCAGGAAGTATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGCTCTTTGTCGACTCCC
GGTCGAGCGAGCCCCAACGGACCAGTTCTCATGGAACTCGGGTTCGCCGAGCAGCATGACATTCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGC
GCGACTGCCCCGCGGAAAGACTCCGCAGACGGACTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGACCCCGGGGGCAGGGGAACACCGG
AAACCAGTAGGGGAAGGGGGCGCCCTGCTTGTGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCCTTCCACGAAGACTTAGCCCCTGACAGTCT
TCGCACTCTCGAATCGGCGAGGAGCAGCGGCGGGTTGCTCGTAGCACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGGTTCTGGG
GCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGC
GACTGGCCGACGAGAAGTCGTCACCGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGAT
ATGGATACATATGATGTGATCCGGTGCAAGCCCTGGCTTGAGAAGCACGAGCCCTGGAACGCCTGACGAGGCAAGGCAATTGGTGCCAGCCGCCCTGCGA
AGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGG
AGTCGTTGACGTTTTTGACGACTCGAGGATGCTTTGATGGTGGCGGCGCCCAGAGAAGGCACTGGTCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACA
TAGTTTCGCAGACAGCTGCAGCTGTCACGAACGCTGGCAATAGCGTGTTCAAGGTGGGTAACAGAGCTCCACACACGGTCGCCCAGACGTTTACTGTAGA
GGAAGACGTCGGATACGCTTCCTGTGTAGATAACATAGTGCCGCACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGACACGCTTCCTGTGTG
GGTAACTCAGTACCGAGGCCTCGAGTGCCTCGGATGTCGGCGCTCCGACATCCCCAGACGTGGGTAACAAAGTTCCACGTCACGGTCACGGTCGCCGTCG
ACGACGTCGCTTCAAGCGACTCGGGGTCCAGGGCCCGGGCTCCTCTGATAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTAACC
CGTCAAGGCATCTGGTGTCCGCTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGCAAAAATGACGGTCGAGTCTTTCCAGGCCAGCCTCAAG
GCTGGGAAAGTTGCCGAGATGGTGCTCATAAGACCTAAGACCACTCGGGAGGAGCTGAACTCCTCCTTTGTCTTGGACGAGGACGTCCTGGAAGACTTTA
ACAAGCCGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAGCAAACACCCACTGTC
CCAACTCCCACCAGATCGGGGTGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTACTATGTCACGAGGCAATGGCCTCTTCGCTGCGAAAGCGAT
GGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACCCGACGCCAACTTTCTGCGTTCGGAAACCGAACAAAAGTGGCGTCTAGTCCACGCTTATAACAAGC
TAAACAACGCGACGGTGCCGGCCAAAACACTAATCCCACGAAAGGATGGGTTGTTAAACAACATGACCGGAGGCGTACAGCACAGTGCGCTGGATTTGGT
AGACGGATACTACTAGATCCTGATGCGAGAGAGGGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAG
GGCTTGTCTAACGCCCCGGCGACATTCAACCGCCTGGTGACGGAATTGTTCAGGCCACCGCGCGCCTTCGTACAGACGTACTGTGACGACATCTTCGTCC
ATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTGGGGCACCTCCGTCGAGTGTTGGACGTGCTGCGAGCGAACAAGCGCTACGCCAACAT
CGACAAGTGCGTCTTCGCGTCACCAGAGATTAAGATTCTCGGCTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCA
GCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGATTGGGCTTGGCCAACTACCTTCACAAGTACAGTACAGGGTACTTGGGCTTCGCTAAGC
TTTTGTTGCGCCTCCTTCAGAAGAAGGACGTCGACTGGCACTGGGAGCAGGAGCATCACAATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCC
TGTCCTGGCCATGCCGGACGAGACGAAGCCGTTTAGCATCGTCTGCGATGCCTCCGACGATGCCATCGGGTGTGCACTGCTGCAGGCCGACACGGCTGGA
CATGAGCGCGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCTGTCGAACGGAACTACCTTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTG
TGCAGTTTCGGGCTCACCTTCTGGGCTCACGGCCCTTCGTGAGCTACACAGACCACGGATCCTTGAGGACGGCGGCAAATTCGCCTCACCTCTCCCAACA
AATGGCGAGGTGGCTTTCCTTCTTCGCGGAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC