Description :
From Genome Similarity Track
Location :
contig_21:398057- 400068
Transcript NameFunction/comments
g4606.t1XP_008897855.1 hypothetical protein, variant 2 [Phytophthora parasitica INRA-310

Sequence
2011 bases(100 bases per row)
GTGGGCTCATACCTCACGAGTCCGTTCAACAACGGACCCGTGAACGGCACGTACATGTGGTCGGCAGAGGAGTGGCGCGAGGTGGTCACAAGGATCCAGG
ACATCACCATGGAGGAGAACGGTGGCCACCCGATGGTGTACGGCGTCGACTCGGTGCACGGCGCCATCTTCGTGAAGGACGCCGTGCTGTTCGGCCAGCA
GATCAACGGCGGCGCTTCGTTCAACCCCGACCTTGTGTACGAACAGGGCCGCATCACGGGCCGCGACACGGAGGCATCGGGCGTACCATGGGTGTTCGGC
CCCATTCTCGGCATCTCGCGCAACCCGCTGTGGGCCAGAACGTTTGAGACGTTCGGCGAGGACCCGCACCTGAACTCCATTATGGGCGACGCCATCATCC
GCGGCCTGCAGAGCAACAACCACACGGCCGCTTGCATGAAACACTGGATAGTTTATCCTAAGACGCCTTCGGGCCACGACAAGGACGCCGTGACGGTGTC
GGACTACGACATGATGAACTACTTCTTCCCGCCCTTCAAGGCCGCCGTGGACGCCGGCGTGATCAGCGCCATGGAGAACTACATCTCCATCAACGGCGTG
CCCACCGTGTCGAACACCAAGCTCATGAACGCGCTGCTGCGCGACGACCTGGGCTTCGACGGCATGATGGTGACGGACTACGCCGAGATCAACCAGCTGA
CCGACTTTCACCGCACCGCGCGCAACGAGACCGAGGCGACGCGCATCTCACTCACGCGCGCGTCCGTGGACATGAGCATGGTGGCGCAGGACACGAGCTT
CTACAACGGCACGAAGGCGCTGCTGGAGCAGAGCCCGCAGTTCCGCGAGCGCCTCAAAGCGTCGGCCCGCCGCGTGGTCAAGATGAAGCTGCAGTGGGTC
TGTACGAGACGCCGGTGCCCGGGGAGGAGAACCTGGCACTCATCGGCAACGACGACGATATCTCGGCGGCACTGGAGCTGGCGCGCGAGTCCATCGTGCT
GCTGCAGAACAACGACAGCACGCTCCCTATCGCCGACGACGCGTCGGTGTTCCTCACGGGCTTCACTGCCGACAACATCGGCCGCATGTGCGGCGGATGG
ACGATCGCGTGGCAGGGCTACAGCGACCAGGATCACCTTCTCACGAAGGGCATCACGGTCAAGTCGGCCATGGAGACGCTCGTCGGCAACGACAGCTTCG
CCTTCTTCAACGGGTTGCACCCGAACGGGTCGTACTCGGAGGCGGACATGGCCACAGCCAAGGAGATGGCTGGCAAGGCCGAGTACACCATCGCCGTGAT
CGGCGAAGACACGTACGCCGAGAAGCCTGGTGACATCGACGACTTGGCGTTGCCCGCCGGTCAGATTGAATACGTGAAGGAGCTGGCGTCCACGGGGACC
AAGGTCATTCTGGTGCTGTTTGAGGGTCGTCCGCGTCTGCTCGGCGACCTCCCCGAGAACGTGCACGCCGTGGTGAACGGCCTATTGGCCTGCGAACTGG
GCGGCCAAGCCATGGCCGAGATCATCTACGGCAAGGTGAACCCGAGCGGCCGCATGCCGATCACGTACCCGAAGGACCAGGCCAACATCCAGCTGACGTA
CAACCACCCCGTGACGAGCATGTGCCAGACGCAGGAGTCCAGCAGCGCCTACTACTGCGAGAACCAATGGGACTTCGGCACGGGTCTCAGTTACACCGAG
TTCTCCTACTCGGAGGTGCGTCTCAGCCGCAGCGTCGTGGAGGTCTCGACCGAGGACGTCGTGGTGTCTGTGGACGTGACAAACTCTGGCAGCGTGGCCG
GCAAAGAGACCGTGATGCTGTTCCTCATTCAGCCGTTCAACTCGCTGAACGTGCCGGAGATGAAGCAGCTCAAGAAGTTCTCCAAGATCAGCCTCGAGCC
CGGCCAGACGCAGAACGTCGAGTTCACGCTCACGGCGGATGACTGGAGCGTGTACTACCCGCAGGTGGGCCACGGCCTCAAGAAGGTGGCCGAGGACTGC
GACTTCGTGGT