Description :
From Genome Similarity Track
Location :
Scaffold_30:398025- 401122
Transcript NameFunction/comments
Phyra_78308PREDICTED: uncharacterized protein LOC101249675
Phyra_78309glutathione S-transferase, putative

Sequence
3097 bases(100 bases per row)
ATGTCAACGACTCGCCCGTGCTGGACGTGGAGCCCGAGGCGGCGTGCGAGGCGGCCACGGACTGCCTCGCGCAGGGGCTGCCGCACAGCACGTGCCGCGG
CGGCGTCTGTGTGGACGACGCGCTGTTCCCGCTGTCGCGCGAGGAGGTCGCCGGATCGATCGGCGCCTTCGTGGCCAGCATCCTGGCAGCTGGCTCCGGA
CTGGGTGGCGGCGGTCTGCTGGTGCCGCTGTACATCATGCTCATGAGCATGTCGTCGCACGAGGCTGTACCGCTGTCCAAGGCCACCATCTTCGGAGGAG
CCATCGCCAGCTTCATGTTGAATGTCAGAAAGCGCCACCCGCTGGTGCGCAGCCGCCCGCTCATTGACTACGAGACGATGCTGCTCATGGAGCCCATGAC
GCTGGCCGGTACCATCATGGGCGTCAACATGAATGCGGTCTTTCCCGAGTGGCTCATCACGGTCTGCATCGTGTGGCTGCTTACCAAGACCGCGCTGCGT
ACGTACAGCAAAGGAAAGAAGATCTGGAAGGAGGAGACGGACGCCGACAACAAGCTCATGGCGGACATCGTGGCCCACTGGCGGCTGCTGCCGTACGAGC
CCAACTTCAAGCAGTTCCAGGTCGTCGCCCGAGCGTATCTCAAGTGGAAGGCGTACAAGTCGCCGGAAAAGGAGGAGCTTCGACTCAAGATCTTGGCCGA
CAAGGCGAGCAACGAGGACGAGCACAACTCGGCGACCAGCACGGAGGAAGAGGCGAGCAGCGACGAGAACGAGAACGAGTCGCTCATGACTTTTGCACTG
CAGGATAAGCGCCCCGTTAAGTTCCTCTCCGTGGAGCAGATTGCCAAGGCGCGACGTACCGTCCCCATGGCGGACATGGGCGTGCTGTTCTTGACGTGGA
TCGGATTGGTTGCATTTTCGATGGCAAAGGGCGGACACGGCACGCCCAGTGTCATTGGGCTCTCGTGCGGAAGTGTCGGCTACTGGATGCTCATCATCGT
GTCGTTCCCGTTTTTCATGAGTGTGACAATCTACTTCGGCATGAAGATTAGCCGGTTCCACACAATGCTGCAGGCCTCCGACTACACGTACGCTAAGGGC
GACATGGTCTGGACGAAGCACGCCGTGATCAAGTACCCGGCGCTCTGCACTGGCGCTGGCGTAGCTGCTGGTCTTCTGGGCATCGGTGGCGGTATGGTGA
AGGGCCCGCTGCTGCTGGAAATGGGTCTGCTCCCGCAGGTGTCTTCCGCGACATCGTCCTCGATGATCCTTTTCACGTCATCCGCCACGACGATCCAGTT
CATTATCCTGGGCACGCTGTCGGTGGAGCACGCGCTGTGGCACGGCGCGGTGGGCTTCGTCGCCGGACTAATCGGGCAGCTGGGCATGACGTACTTGATC
AAGAAGTACCGCAAGTCGGCGCTTGTGATCTTCCTCATTGCAATCTTCATCGGAGTGAGCGGCGGCGTCATGGGCGTGCTCGGCGTGGTGCGCATCTCCG
AGATCGGCTTCGGAGGCTTCCGCTCGCTCTGTCTGAGCGGCTAAACGACGAATCGACTGCTGCTATTGCTCGTGCGACAGCTCTAATCACATATTATAAC
TTAACATGCACACTTCGGTTGCCTTCCAAGGCCACTTGCTTGCCTTTTGTTTCCGGTGCAGGTGTTTATGTCCTGCAACTTCAGCTAAACACCATTCGGT
GGCACTAGTAATGACGTAATCACCATTTTGTAAACGCAATCGGTGACAACAGGAATTCGGATACCATTCCGCCTCTTCATTATTGAATTTGCGCGCCCCC
CCCCCCCCGCAAGAGCCTTACCACCAAGCCCCATCACCCGCACAATGAGCGCCTTCCCGTCCATCAAGCTCACGTACTTTGCGTCCGCCGGTCGCGCCGA
GACACTGCGTCTCGTGTTCTACGTCGGCGGCGTTCCTTTCGAGGACAAGCGCATCACCCACGCGCAGTTCGTCGCCATGAAGGACTCGCTACCGCTGGGG
CAAGTGCCAATCCTCGAGGTGGACGGCGAGGTCTTCACCCAGTCGCACGCCATGCTGCGCTACGCCGGCAGACTGGGAGGACTCTACCCCGTGAGCGCGC
CCTACCTGGCGCTCAAGATCGACGAGCTCCTGAACGCCATGGGCGAGGTCGAGGAGAAGATGGGCCCGTCGTTCCGCGAGTCCGACGCCGACAAGAAGAA
GGCCATGCGCGAGGAGCTGGCCACCGTCACACTGCCTCGCTACGCCGGACTCTTTGAGGCTCGGCTGCAGCAAATGAAAAAGATCCCGGCCTTCCAGACA
GACGACGTGTTCGTGCACGACGTGGTTATCTACGCTTGGATCAAGTCGCTGCGTGCTGGGTACATGGACTTCATCCCCACGACGGTGCTGGACGGCTACG
AGCTTCTGAACGCCTCATACGACAAGGTGGCCAACCACCCCAAGGTCAAGGAATGGTACACCCTGCAGCACAACACGCCCAAGATCAAACTCACGTACAT
GCCGCACCCTGGCCGTGGAGAGCCTATCCGCCTCGCCTTCTTCATCGGAGGAGTCGAATTCGAGGACGAACGCATCACGCGTGAAGAGCTGGCCAACCGC
AAGCCTTCGCTGCCGTTCAACCAGCTACCCGTGCTGGAAGTGGACGGCGAGGTCATTGCCCAGTCACTGGGACTGCTTCGCTATGCTGGCACCCTCTCGG
GATTGTACCCGGTAACCGACCCGGTGGCCGCTTATCGCGTGGACGAGCTGTTCGCGCTCCTGGATGACATGTTCAACTTCCCGCTCTGGGGTGCTTCTCA
CCGTGAGAAGGACACCGACAAGCAGCTTGCGATGCGCGAGGAGCTGTCCAACGGCATGGTGGCCAAGACGCTGGGCTTCCTGGAGAACCGAATCATCAAG
AACAAGGGCCCTTACGCCGCTGGTGTGAACCTTACCGTAGCTGACCTCGCCATCCACGGTGTGCTTCTCGGCTTCAAGAACGGCGTGCCCGGATTCTCCA
AGACGATCGCGGACGCGTACACGAACCTGCAGCGTGTCTTCAAGCTGGTGTCGGAGCACCCGAAGGTTGTGGAGTGGAACACTGCGCACAACCAGTA