Description :
From Genome Similarity Track
Location :
Scaffold_632:398- 3992
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_632-abinit-gene-0.44DEAD/DEAH box RNA helicase
Pytir_DAOMBR486maker-pir_contig_632-snap-gene-0.6Transmembrane protein

Sequence
3594 bases(100 bases per row)
GCAGGTGTGCAGTCGCTACGGCGCGTACATTTGCGACGCGACCGACGAAGACGTGTGCAGCATCGAGTGCCGTGATGTGTGTGTCATGCGCCATCGAGAA
GCACGTGTGCTGAGCGAGGAGCAAGTTAAACAGCGCGCGTTGGCAGCGAAATTGTTGCGCAGGCGGCTGGAGATCCGCGTCACGTCAGGCTCTGCTGCTA
CTGATGCTGATGATGATGGCAACAATGCGCACAGTCCAAACAGCAGTACGCAGATGATAATCCCGTTTCCGATCGTAGACTTTGCGGATTGCGATTTGCC
GTCGCAGCTGTACGCAAACATGCAGAAGAAGCTGTTCGAGAAGCCCTCGCCCGTGCAGATGCAGGTGCTCCCGTGCGTCTTGGCGCGCCACAGCGTACGT
ACGCACGAACGTGTTTTGTCGGCCTTTCTCGTTAATGGATGGGAATTAGGCTGACTGTTGTATTTGTCTGTACATGCGTTAAAATGCGCAGCTGCTGGTG
GTCGCGCCAACCGGAACAGGCAAGACTGCAGCGTACCTGATCCCTATTATCGCTCAACTCATCAACGGGCGACTCTCCTCCTCTTACCATCATGATGATA
CAGCTGATGGTCTCAGTAGTCACCGCTCAAGTGCGGTTGCGGTGATCCTTGCGCCGATCCGTGAGCTCGCGACTCAGATCGAAGAAGTGGCTAAGCTACT
CGCGCAGGGCGTTCCAAATATGAAGACGGCGCTGCTGGTCGGTGGCTTTCCCATGCCACCGCAGCTGCATCGGCTGCAGAGTGGCGTGCAGATTGTCGTC
GCGACTCCCGGGAGGTTCATTGACGTTTTCACAAATTACGACCTCGGCGTGAGCAACAGTAGTGATACGGACCAAGGCAGACAACAGGGGACGTCGCTGG
CGTCCGTGGTCTGCTGCGTGGTGGACGAAGTGGACATGATGCTCGCCATTGGCTTCCACGCGCAGATCTCGCGGATCATTGGGCTATTGCCACCTCTTGC
ACAGATGCAGCTGCTCTTCTTCAGCGCGACGATCTCAACTCAAGTGGAAGCGCTTGTGAAGCGAATCCTCCTGGGAACGAAGACTCCACAAAGTGATCAA
CAGCAGCAGCTTTCCAACTACTTTCGCATTGAAGTGGGCGGGAAGAAGCAGCGACAAGGCGACGACGCGAACTTTTCATCATCGTCCACCACGTACACTG
CGAACCCGAACATTCGTCAGAAAATCATTTGGGCAGAGGACAAAGCGAAGAAGAAGCTGCTATTTGATTTTCTCAAAAGTAAGCAGAACGAAGCCACGGT
ACGTTACATTGTGAGCTTTCATTACAGAGTTTGCTACTCTGATGTGTATCTGATTAGTTTCCCCCTCCCTCTCCCCTTGTTATCCTACAGCTGGTGTTTG
TCAAGTCCAAGATCGGCGCGAACCTGCTCGCAGACGCGGTGGAGAAGCAGACGCGGATCCCTTCGGCTTCCATCCACGCGGACAAATCCCAGAAAGACCG
CCTACTCGCACTCGAAGCGTTCGTGAACCAGGATGTTCGTGTGCTTGTGTCGACAAACGTGCTGAGCCGTGGCATGGACTTGTTGCAGGTGCAGAATGTG
GTGGTGTTTGACTTTCCAAACAAAGTTTCCGACTATATCCACTTGATCGGTCGCACGGGTCGAGGAAACGATGCGAGCGGGAATGCGCTGGTGATGGTGA
ACAAGGACGACAAAGTTATGTTCAAAGAGCTCGTTGGGGCTTTACGCGACGCGAAAGTTGGCGCGGTGCCCCGAGAGATCTACCAAAGTCTCTATGCTGA
CGCGCAGAAAGAAGCTTTCAAGTCGAGCGCGTTGGTCATCGACGAAGCAAAACGCGCGTTCCGAGTGCAAGACGAATTGGGAGGTGAGCTCGGCCAATCC
CATGAGAGCTGGCGCCAGTGGTCGAAGCAAGCCCAGAAGAAGCAGCGCCAAGCGTAATCCACGATTCCTTATTGCATTCTCTGAGGGCTGACGACCAAGT
TCCATTCGCAATTGGCTGACAGCCTCTTGACGTGGAAGAGCATACTTCACCATCTTCTTCACAACGGCGGGGCGTCAGGAACTATAGTCGGGAACATAGA
GTCGGTCTCTGTTGCGTGGAGGGGAGCGACTCGATTGTCAGGACCGCTGATCTTCGTTGCGCGCGTTCTCGCCCGTGATTTGCGCCGCTTTCCCGACACC
AAGTAGTTGTCGTAGCTCACAGCTCCTCGCAAGATGATGGTGTCTTCATTCGACGCTCGCGCCAAGCGATTAACGAGTCGACAGCACCAGAGTGTTAGTG
TGACCAAGCGGCTGAAGTAGAACGGTACGACGCGAACTTGCAAGTGGTGGTCCCAAATGACTCCCTCCCACATGATGCGATCTGCTGGTCCCAAGTCGCC
AAGAATGTTGTAGAGTGTGGTGACGTGCCAGAGGATGAACATGGCGACGACTGGGATCGCGAATCGAATGTGGAAGTTCAGTTTGGTCTTCATTATCGGA
GTGAGCGCGTCCAACGTGAGCACCCAGAGGATCCACACCCACGACGTCGCGACTCCGAAGCAGCGGTGGATGTCCCATTCGTAGAGGATGCAGAGCGACA
CATGGATTGCCATCAGTTGAGCCGCGTAGAAGACGAAATCGAACGACGTCAGCAGCGAGAAGAGTAGCTCGCGCTGGTACAAGCTTGCGGTTGCTGTTGT
GAAGCTGATGGTCAGGATGAACGCCAGCGAACCATGTTGCAGCACGTGATGGATGGAGGTATTTGTGGTAGCTGCGTCAACGTCTTGCGGTGTGACGGCC
GTGGTAAATGCTAGCAGAATCCCGCCGATACCGGAGCTGTACAGGAGAACCAGGAGCACGCTCGGGAACCTCGCTTTGGTGACAATTTTGACGGGCAGGA
TCGTCTTTCTCGAGTCGAAGGCATGCTCGTCCTTCTCGTAGCGCATTTGCTGGACGAAACTCGGTCGTCGCGCTCGAATGGTGGTGCTGCCATTGTTGGA
GGTAATGGTCGGAGGAGGAGTTGGAGGCATCGTGGCTGCTGCTACTGCTGGCTCTGAACCGATTTGAACTCTGCAAAGCGCCAGCTTGACACGACAGCGG
AAGATGGCGCACTCGATCAGCTTGCTTTTGCCGCGCCGCCGCCGGAAGGACTTCCGCTTCCGGTAGACGATCTTCATGAGCAGGATCATCATCGTGACCA
AGCCGTTGCCGACGACGTCTTTCGCTGAGACCTCATAGTGGCTGAAGCTGTTGTGGTACTCCATGATGGAGAAGTCCTTCATGTCGTCGACGCGGCCGAG
CATCACGCACGTGAGCAGCATGAAGACTGTGAATGTGCCGACGACCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGCTGAGCGTCGATGAG
CACGATGTTCTGGAAGCCCGACCAGTCGATGAGCAGCCGTGTCATACGCAGATCCGAGAAGAGCACTGCGACCATCAGGTTGGTGGTTCCGTTGACGAAG
AGGAAGAACCAGAAGTCGTACGTGCGTACGAGAAGCCGCACAACATCGAAGCGCAATGTGCCCAAACTTCCGAGTCCCAGCGGCAGTCCCAGCA