Description :
From Genome Similarity Track
Location :
Scaffold_155:398- 3408
Transcript NameFunction/comments
Phyta_totarag4717hypothetical protein
Phyta_totarag4718hypothetical protein PHYSODRAFT_248056

Sequence
3010 bases(100 bases per row)
gtACATTCGTGCTTGCGAAGTATCCCAGCGCGAGGAGCGTGCTTCATTCTCGCAGGCTCAATTGCAGTCACTCCGATGGACTTCGACTTTGGTCTTCCGC
CTGAAGCCAAGCGGAGAACTGGTGCAGTGGTCTTTGTAGACCGTTTCAGCAAGATGgagcatcttgctgcagtgccggCTGAGGTAACAGCCGTGCAGAC
AGCCCACTTGTTCGTAGACATGGTGTNAAGAGCTACGCGCACTCGTTCCATCATTGGAGCGACTGCTTGCCGATGGCGGAGTTTGCCATCGACAACTCGG
TGCATGCCTCGACTGGGCATACATTGTTCTACGTGAACGCCATTCGGCATCCACGCCTTTCGAGCATGCTCGGGGCGATGGCTTCCTCCTTAAGTGGGGG
AGGGTCTATGGCTGCAAACCAGCAACGGCAGAAATCAACTGATACGGTTACAGTATCAGTTACGACGACGAACAAGAACACCGTGTCTGAGCCGGGAACA
GACACCGCGAAGGACGACGCAAAGGCTGGACCTGATGCGAAAGGCAAACACGCATGGGCCGGGCCTGTAGTGGAAGCCGCAATCGAGCTGAACAAGTCAT
TCAGCTCGGAAGAATGGACTTTGTCCAGCGTAGACAAGCCGTCATTCAATTTGTCCAAGATACTattgcagcttctgctgatcAGAAGAAACTGATCGTT
GACACTGTCGGCAGGGACAACACAAATAAATTCATAACGGGTTCATTGATCTTACTAGCTACGCAAAACCTAGCTAAGCATGTCGTCTCTATCTTCGGAG
CAAACAAGCATCGTGTCGTTTACAGTGCTCGAGCGGCATGGCAACGCTTAAACGTTGGACATACTGTCCAACATGCGCTTCCATCCGACGTTCTACATCG
GGCGGCTAAAGCCGTACGTGCAGCATGAGCCACTTAGTGTTGGTGACaggccgaagaagaggaagaagcaggggCCAACTGCTTCTCAAGCGACGAGACC
TGCTTCTCAAGCGAAGCGACttgcttcatcaacttcgcGAGCTTCATCCCAAGCTCGACGCTCAAGTTTGAGACGGTCTGTGATAGCGCCGCAAGCTGAG
CCTTCTGAAGGCTCTTCCCCTGCTTCAGAGCGCGAACTCTGCACCCTGAAGCGTCCCCACGCCCGACACTCGGTCGAAGAGACGGGAATCACCCTGCTGA
ACGAAATGTTGACTATTCGAGGGGCATGTTCCCAACTCCACTGCGTGACGCACATGGTTTGACCCGCTGAATTGTGGAGCAGATCATTGGTCATACCAAC
CTGAAGTGAggctcgtcttcgtcttcgttggAGAGAATTGGGTCCCCACCAAGATACATGGAAACCTCGGAACGTCCTGCATCAGGACGTTCTGGAATAG
TGAGGGCGTACGAAGCCCACCATGGACGGCAGACGTAAAGCTCGCATTAGCGTTGCAATTACCAACAACGTTCGGAGCGTCACGTGCTTGCAGACTAGCA
CGGAGCTCACGAAGACTATCAGGTACACGCACGGTCGTGTACCCGTTGAGATCACACTCACTCAAACGCGCTGCCCCGGATTGGCAGTGCACACACAGCA
TTCCGGCGGGCACTGCGCAGGGAATCCCCGCCTTAAGTGCCTCGTCGTGCAAGCGATATAGCTTGCCacgcttcgagaacttctcgaaacgTTCACGTGC
CGGGGTATTCCGAGCACGGTATCCAGCAGggtcgttgttgaagttttcaACAATGGTATTCCAACTTTGGCAAAGTACTTGGCGCTCGGGCATTTTACTT
TTGCGAGGAGTTCTCTTACTCGCATAgtgtcggagctcatggaaTAGTTTGACATAGGAGTCCCACCCTTGCTTCGTCGGCGGATCAAAGTTCTGAGTCT
CAGTCACAGTATCGTCATTGATGCCGTTGACCGCATACAACGGCCACTGCTTGGGTGACGCGTACGCACCCACTCGATCAACCATCTCGAATGCAGTGGG
CGTCCTCGGGTCGCGCACTGTAGTGTCCGTGCGCGGAGGCTCAGGATGCGTAGACGAAAGCCCTCCCGCTGCGGCGAGCGCTGATACTCCAGCACTTCGC
GAGCGCTTTGGACTTAAAGCGCTCGAATCATCTTCGCGCGGGCGACGCGACAAAGCGTGAAGCTCGCGCGCAACGAcagctgaggacgaggaaaCTTTTC
GCTTTGAAGACGAGacttctcgtcttccatctctTGACCTTCTTCCTCTGAACTCATTTCATAGTTGACAGGAGTATGGCAGTCTCCGTCACCGGAAGTT
GCTGATGGATAAGCAGGAACAGACTTAGATTTGTCTGTCCCAGAGGCGTCACCACGCTTCTGTTTCTGCATAGCGTGATATCCAGCGACAGAGATACTAC
CCTTTGGCGTGGAGCTAGGCGTCGCGGGAGTCGGTGTACTAGCTGGCGAGCTCATTGCGAAATGAGTTCGAGTCTTTCTGAAGTATTGATGGGAAGATCG
ATAAAGTTATTGACATGTTGGGACCGCCATGTCTTTGGCTTATCGGGGGGATGATGTAACGGGATAACTagtacaagtggctacatcacttgtaacctaa
ccGAAGTGGCTACGGTTAGAAGTTAGGATCCTCCTTCattggtgtgaggcacaccaatggctacatttagaCGGACGATTGATCCGTATGCATTTAGGGC
CCTCATTGGCAGAAATCAGCATCGTTctaccaattagaatcataggattctgccgaccaccaGTCGGCAGAaccctattacatagtatggCATTTAGGAG
GGAAACCttgacaaataagcaaataaaacaTAGTTatcaatttcacctaaagtgttaattatcATCTTTAAACTAGccttaattatacttgcggggcgcA
AGTATTATAAAGCCAAGTCACAGAAACGTACGCTTCCTCgcgtgtgcacacgtgtaagctaaAGTATTGGGCTGAGTAGGCATATTACAGGATATGCATT
ATATGCATGC