Description :
From Genome Similarity Track
Location :
scaffold_4:397885- 400249
Transcript NameFunction/comments
g4819.t1 propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2364 bases(100 bases per row)
TCTGCACGTCTGCTGGGTCGCGAGGTGCTGTCCGCACGCAGCGGCGCTTCGCTGCGGCGCCTGCAGCAGGCCGCGGCCCCGCGGGAGAAGCTTTTCGACA
AGATCCTCGTGGCCAACCGTGGCGAGATCGCCGTGCGCGTCATGCGCACGTGCCAGAAGTTGGGCATCAAGACGGTGGCCGTGTACTCGGAGCCTGATGT
AGACTCGGTGGCCGTGCGCATGGCTGATGAGGCCGTGTGCGTGGGGCCCGCGGCCTCGGCCCAGAGCTACTTGAGCATCCCCAAGATCGTGGCGGCCGTC
CAGGCCACGGGCGCCCAGGCCGTGCACCCGGGCTACGGCTTCCTCTCGGAGAACAAGGACTTCTGCGAGGCGCTGGAAGCCATCGGCGTGGCTTTCATCG
GGCCTGGACACGCAGCCATCCAGGCCATGGGAGACAAGATCGAGTCCAAGCAGCTGGCCATGGACGCAGGCGTCAACACGATCCCGGGCTTCCTGGGCGA
GATCGATACGCCTGAGGAGGCGGTAAAAGTGGCCCAGGAGATTGGATATCCCGTCATGATCAAGGCCAGCGCTGGCGGAGGCGGCAAGGGCATGCGCGTG
GCTTACAACGACGACGAGGTGCGCATGGGCTACCGCCTATCCAAGGAAGAAGCAGCCAGCAGCTTCGGAGACGACCGCATGTTCCTCGAGAAGTTCATTG
AAGACCCGCGGCATATCGAGATCCAGCTCATTGCCGACTCGTTCGGTAATGTGGTCCCGCTGCCCGAGAGAGAGTGCTCGATCCAACGGCGCAACCAGAA
GGTGATCGAGGAGGCGCCCAGTGTGCTACTCGACCCGGAGACGAGAAGGGCCATGGGCAAGCAGGCGGCCATGCTGGCCAACAAGGTGGGCTATGTGAGC
GCCGGTACGGTCGAGTTCTTGTGTGATAAGCACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGCAGGTGGAACACCCCGTCACAGAACTCATTT
CTCACGTGGACCTAGTGGAGCAGATGATCCGTGTCGCTGCAGGTCACGAGCTGCCCAAGGAGTTGGTGGATGGACCTGTAAAGATCCACGGCTGGGCGAT
GGAGAGTCGCGTGTATGCCGAGGATCCACTGCGTGGTTTCCTGCCGTCTATCGGCCGGCTGCTTCAATATGACGAGCCCGTGCACCTCCCGGGTGTGCGC
GTGGACTCAGGTGTGAACGAAGGCAGCGATATCTCCATGTTCTACGACCCGATGATCTCAAAGCTCATTACGTACGGCAAGGACCGTTCGGAGTGTTTGG
AGCGCATGAAGATTGCGCTGGACAACTACGTTATTCGCGGCCCTGGCAACAACGTTGCGTTCCTGCAGGATGTCTACCGTCACCCTCGCTTCGTGAGCGG
TAAGATTACCACCAAGTTCATCGAAGAGGAGTACCCGGACGGCTTTGAAGGTGTGAAGCTGACAGCACCTGAGATTGAGGACCTACGGGTGGTTGGCGCC
ATCATGCACCTAAAGAAGGCTATTGCCAGCAGCCAAATCTCGGGCCGAATTCAGTCAACACCAACGGAAGGTTTTCCCTCCTTCGACTCGCTCAACAATG
ACGATTTGGAGTTTGTTTCTCATCAAGAGGGAGTTGTCCCGCGCCTGCGTGCTTTCACCCCTGGTCTATCATCGGCGGAGTTGATCGCGATTGCGGAGCG
AAACGACCTCAAGAGTCTCGGTGCTCAGCTGTCGGTTAGCATCGATGGACCATTTGGAGAAGCGAAGCCTGTCGTTGTTGTCGAAGTGGAGCTTGAAAAC
GCGCGGCACCGCATGGAAACGGCGACGCTCGCTTTTGTCGACAACAAGTGGCACGTTGTGGGCGATGTGGATTGGTCGCTGAACAGTCCGCTCTTCAAGG
CGTCATACGCAAAGCAGAACGGACCCAAAACTGCGCTGGCGTCGCAAATGCTGCAGACGCTGCCCGAGGGATTCCGTCTCCAATTTCACGGAGCAGTCCA
TGATGTCGTCGTACGCAACGAATTGGAGGCTGCGTACGGCATCCACATGAAGCCGAAACCCGAGGTCGACACGTCCAACTTGCTGCTATGCCCGATGCCC
GGCATGCTCATCTCAGTGGCTGTCGAGGTCGGCCAGCACGTGGAGCTTGGGCAGGAGCTAGCCGTCGTGGAGGCTATGAAGATGCAGAACGTGCTGCGCT
CTGAGAAGAGGGGCGTCATCAAAAGCATTGCGCATGCTGCTGGTGATTCACTCAAGGTTGACGAGATCATCCTCGAATACGAATAAGCGCTCTATGCTGC
GCTACAACTGGAAGGTCAACCTAGGCTAAGACGTAGCGGTGCACATGGAGATATGGAAAACAAA