Description :
From Genome Similarity Track
Location :
Scaffold_20:397853- 401634
Transcript NameFunction/comments
Physo_132338hypothetical protein
Physo_132339hypothetical protein
Physo_132340hypothetical protein

Sequence
3781 bases(100 bases per row)
ACGACGACAGCTTATCAGGTGAAGGTCCTGAAACGGATTCTCAGATTCAGTCTGCAGTGTTGGAAGAGCGCACCCATGAGCTCGAAGGGCAAGTGGTAGG
TGATTTTCATTGTTAACCGGATTACCATGACTTCCAACCTGACTAATGCTGACTCATGTTGTTGTTGGACGACAGGCCCGGCTTGAAGAGCATCTTGCGG
CCGCCAAGAAAGAACTGAAGAGTGCGCTGGACCGCGTAGAGATCGCCGAGGAGATCTACAAGGCCAATTTGGAGACTATTACTCAGCTGGAATGCGCTCC
TGCCGTGCCGAAGGCGTCGATGATCACGCAGCAAGCGGAAGACACCTCCGAGGTGACCTCGGCACCGCCCGCTGCGACACCAAGCACGCAGCCGGAGGGA
CCTCCTTCGAGCGAGCTGGAGCGCGTGCAGAGACTATGCGCCGCCTTTCAAGAGCCGTGCCTCTGGCGGTCCGTGGAGAACATGGAGCTCGAAGCTCAGC
TGGCTGCGTCACAAGTTGAGGCGACCTCTTGGCGTGAGAAGCACAGCGAGCAAGCCGCGCAGCTCGAGGCGCTGCAGCAGCAGAAACGCACGCTGCGCAC
GCACAAGAAGATGCTCGTGCAGGAGGTCAAGCGGCTGCAGCCGTACTCGCAGGTGAATCTGGCGGCGCTAGTGCAGGAAGCGCAGGAGGCCCGCATGGTG
CAGCGCAGTCTGCAGGCCAAGCTGGACTCGCACGAGCAATCGGCCAGCGGCGTTGCGGGAAGCGTCGAGACCGCCGACTTTGTGCTCGTCGAAGCCTCGG
AGGAGGAACCGTGAGATCGGCACTACTGTATGTTGTTGGGTAAAAGGCAATGGGGAGTATCTTGTACATGAAGTGTACGCTGTGGCGCGGTGTCCATGAT
TGACGACACTTGTGGAACATGTTGAAGCAGTCTCCGGTTAATTCCCGCTCGGGTACGCGGGACAAGCCACCTGGTCTTCATCAACCTCCACAGCACCAAC
TTCCGTCATGCATTCACGCCATCTTCCGTCGCAGAGTCATGCTTACGAGCCATCTTCCGTCACATGAGTACCAACTTATGCCCTGATTCTCATTAAGGTC
TTAACATATATAAGTACTGTATACGTTCACGCCATTAGAGCACCCAAACTACTGTACTGACTTACCAGCATGACGCCCCATCTTTTTTGGTTCAGCCGGC
GAGGCTCATCAGTCTCCATTATCCCGCGTCCCAGGCCGAGTCGCTGCGTCTCCCGGCCCCTTCCTCACTCGCCCTCTCGCTCGCTGGGACACCGTGTTCC
TCCACTTCCGAGGCCGACGGCAGGCGCCGTCCAGGAGCATGGAGCTGGGCGTGGCGGAGCTGGCGATGGCCCTGCTGGGCGTCACGCTGCTGGCGCTGCT
CGCGCTCTGGATGTACCGCATGGTGCAGTACCGCAAGGCCGTGCGCCGCTCGCAGGCGCGCTGGCTGGACTACGAGCCGGCGCCCGTGCTCACGGAGAGC
GAGCTGGGGCTCAACTGGCCCAGCCTCAAGCCCATCCTGCTGTCCCCCATACCCGAGGAGCGCCTCGAGAGCGGACGGGTACGGCTACTGCAGCTACTGT
GCAGCTGTGGAGAGAGTAGAGCTGGCTGTTGTGGTTGGCTGATTGTCTCTGTGTGTGTGTGTGTCTATTAGGAGTCGGAGAACGACACGGTGCTGTCGAT
GCGCAGGGACTCGCTGCGGCTGAGCGCCATCTCGGTCATCGCCTGTGAGTTTTGACTGACTGAGTGGCTGAGAGAGCGATGGGAGGAGCTGAGGGGCTGT
GGCTGACGCTGTGTCTTTGTGTGTGTTGCTTGCTGTCATGTAGACGGGAGCTTCGATCAGCCTGTGGCCAAGACCGCCAAGGTGTAGCATGCTGTGCTGT
ACGGGGATGTTGATAAGTCATTCTGCTCGTGAAGGAGCTGTGGCCGTCTACTTCGATGAAGGCGACGCGCGGCTCTGAAGGGGGCAGGGGGTTGGCAGCT
TGGGGAGTTTCGAGGAATCGATTGAAGCCGAGCCGGGTATTATTCTGTATGTGCTAGTGTGGATTAGAGCGGACGTAATGGGAGGTTTACAAACAACGAA
AGAGTTCCTAAACATGACAGACAGCGCGGCGTGAAGGAAGGGAAGGGCTGCAGAGACGCACGGCGTCTCGCTCGGCAAGACGCGCGAGCACGCATCGTAT
TTATTAAATAATGGCCGTAATTCTAGCGAGCACGCCTGCCTGTCATTTCTCCTTCTTGCACACGGTTGACTCACTCGCCTGAGTTGTGATTCCTGCCTCT
CGTTGAACTACAGGACAGAGCGTGTGATATAGCGCTGTTGACAAGCAGGTGAATGGTCAAGAGAACTACAGATGAAATGCCGTGTGTTTGTTACTGTATC
GTGTGTAGACGGCGAGGTTGTCCTAATAAAAAAGCTAAAAGCTATGTGCTATGGTCCAGACTTTCTTCCTTGTACGCGTCATGGTCTGGTCATGTCTAGT
CTAATCTAGGGCGAGTTCACGGGGGCTGGCGGGCCTCGCGGCTGCTTCGGCTCGACCTGCTCGTCCGAGACGTCCAGCGTGCCGTTCTGCGCGTGGGATC
TCCGCATGCGGTAGTACTGCGCTGCGTCGTCCGTACTCTTGAAGCGTGGGGCCGGGGTAGCGGGCGTAGCCATCGGCGTCATGAAGCGGTTGGCCTCGAA
CAGGAACTGGTTCAGGTCCACGGCCTTGGTCACGTACTCGAACACGTCGCGCGTGGCGTCGTCCATCTCCTCGATGTCAAAGCCCGTCCGCAGCGGCTTC
TTCTCCGCCGGATCGATCGCTGGCTCGAACACGTTGTAAGAGCCATCCGGGTGGAAGATGTACTTGAGCTCCTCAGTGCGAACGCCCTTGCTTATGCCGT
TGAACGGGTTGCACATGACGACGCGTCGTTCCTCCGGGCTTTCCCGAGCTTCGGCTGCCAGGGCTTCCGCCTCCGAGTCCTTGACCTCTGCGTCCTTGTC
TTTCACGGTCTGGGCTGCCAGAGCTTGCGCTTCGGCTTGTGCCTCTGACTGAACGCGACGGCGCTTCATGGAGTGACCGTATCCGTGCTGGTAAAGCGGC
TCCTCCGGCGTGACACCCAGGATGTCTGCAATCGTGGCCATGAGGTCGGACTGCATCGTCAACTGGTTCACCACTGTGCCCTTGTCTGCCTCGAGAAGGA
AGTCATCGGCCAGCAGGAGGAATGGAACTCTGGACGCCTCATCCCACACGCCTGAGTCTGCGATGGACGGGTTGTTGTCGTGCTCCAGACGCCCGTAGCC
GTGGTCGCCCTCGATAATCACGATGGTGTTCTTCATCAGGCCCTTGGCACGCAGCGCAGCAATAAAGTCGCCCAGCATCTCGTCGGAGAAGTACATGGAG
TCCAGGTACTTCTTGTTGTACCGCGTGTACAGCCCCGAGAGGTCTGGCACATCGTAGAAATCCGGCAGAGCCCACGGATTGTGACTCGTAATACTGTACA
TGTCGATGAAGTACGGCGTCTGGAGTCCTTCCCAGCCAGGAAGCGGTGGCTTCGTCGGCATGGTAGCTGTCGTCGCGGACGAGTCTTCGGTCGAGGTCTT
TGAAGCAGACACCCCGTTCTTACTGGAGTGAGTGGCGTGATAGTGTCGTCCCTTGGCAGCAGCCTCCGGAACCGTCAGTGTGTTCTCGAGGTCGGTCGTA
TTGGTGGACGTCTCGAGCTGATCATTATCAGCTCTAGTCATCTCCGAAGCGCCAACCACAACCGAGCCAGCAGTAGAGTTG