Description :
From Genome Similarity Track
Location :
Scaffold_81:39781- 42672
Sequence
2891 bases(100 bases per row)
TGACAGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAGCTACCCAAGGATAAGGGTACTCGTCACGAGATCTACCTGAAACCAGTTCAAAGTAC
TGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGCGATTGACAAATTCTTTGCCGATCGCTAGGCAGCGGGCCATGTGAGGGAATCTACTT
CCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACATGAGGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCA
AACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGGCTACGAGTACCATATTTTCATCGATGGATCTGATGGACGGGTTCTATCATATCCTTATG
CGTGAAAGGGACATTCCTTATACATCAGTGAGCACCCCAAGCGGTATTCTTTGGGAGTGGTTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGT
TCAACAGACGCGTTACGAATCTGTTGAGATCTATGCGAGAATTTGAACCTAGGTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGAC
GGATTTGGAAGTCCACCGACTCCACGTCCGAAAGGTTCTTACACTGATGCGCGAGCATAAGTTGCCAACCTCAAGAAGTGCATATTTGCTGCAAGCGAAA
TACTAATTCTTGGATTTATCGTGGGTAAGCACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGG
ACTTCGAAAGTTCCTTAGTCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTCTATTGAAAAAGAACGAG
AAGTGGGCATGGAGTGCTGATTACCAGCGCTCTTTCGAAGGTATCAAGCAAAGCTTGATATGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCAT
TTCATGTGGTCTGCGATGCAAGTGATTTTGCCATCGGATGTGCACTAATGCAGTATGACACAGACGGTTCTGAGCGTGTCGTCTGCTATCAGTCATGTCA
CCTGCACCCGGCTGAACGTAACTACCCAGTCTATGACAAGGAACACCTTGCCTCGAAGTACGCTTTGGCGAAATTTAGGGTCTACCTGCTAGGTGATAGA
CCCTTCATCGTTTACACAGACCATGCGTCCTTACGCACGGCTGTTAACAGTTCACACCTCTCGCAGCGAATGGCGAGGTGGTCGTTCTTCGCGGAGTATA
ACGTCTCCGTGGAATATGAGCCAGGACGACTGAATGTCGTCGCTGATGCTCTGTCGCACCGGCCCGATTTCGAATCGGCTGCGCAACCCGACACTGGTCC
GACCACTGTTGCAGTGTTGACGTCGAGTGTCCCGTCGTCAACCTTATTCGAAGACATACGAAAGGCGTACGATCCGGCGATGGTGCGTTTGATGCATCAT
CTCTTGCAACCATCCCGTCAATCCCTAAAAGGGTTGCCCCCAGTATATCGATCTTCCACGGATCGATATACAGTCCACAATGGCTTACTGAAGTATTCAG
CTGTTTCCGGCGACACGCCTCGTGTCGTCGTACCGGACCATGGTGACCTGCGACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGGCATCG
TGGTCGAGAGAAGATATATCTCACAGTTAGTCGCGACTTTTACTGGCCTCGCCAGTATCATTTCGTGCGTAAGTACGTCCGCGCATGCGAAGTATGTCAA
CGGGTGAAGTCTAGTCCTTCACTTCGTGCGCCGTTGCAACCCTTGCTCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGGATTCC
TCGTAGACCCACACAAGAATACAGGTATTCTTTTGTTCGTTGATAGATTCAGTAAAATGGCACACCTCGTCGCTGTACCTGAATCTATCAATGCATCGGC
ATGTGCTCGTATTTTTATTGACACGATCTTTCGTCCTTATGGGTTGCCTCGTGAACTCGTCTCCAATCGAGATCCACGGTTCACTGCTAATTCTGGCGAT
CCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCTGACCACCCTGAAACAGATGGTCGTCAGAATGTGCCAACCGCGTTTATGAGGAAATC
CTTCGGGCTTACGTCCATTCGTTACTAATTGGAGCGAATTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATTGACGGCGCATACACC
GTTCTTCGTGAATGGCTTGCGCCACCCACGCCTACCCACCATTTTAGAGTGTAACTCTAGTTTGAGAGGGGGGGATCATTCGAGCGAACGCCAACTCGGC
TCTCACTCATCGCATACTGACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGGTGCTC
TTACTACCCAGGTCACTGATCTTGCCGCAGTGCGCTCCAAGCGCAATATAGCCTAAGACAGCGAGTCAGCAGATGGATTCATACTGGCTCGCGAAACGGT
TGTCTGTTTCGTGCAAGATTCCATTGCAGAAGTGGTGGACCGACCACAGAAAAAAGCTGACTAGAATGGAAGATCAAACGTTCTTTCATTCAATGAAGGT
GACCTAGGTCTACTACTACGGTAAACCTACCTTGACTCATAGTGACTAACGTGGGAAGTAACAAGTTACTACCCAAGTTCATCGGTCCATGTCGTGTGCT
GCGCCACTTAGGCAACGCATACACGATTGAACTGACACGTAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGTCTTGGGCCTTATCAC