Description :
From Genome Similarity Track
Location :
contig_4:397711- 400074
Transcript NameFunction/comments
g1288.t1XP_002902924.1 propionyl coenzyme A carboxylase (Pi-PCC1) [Phytophthora infestans T30-4

Sequence
2363 bases(100 bases per row)
TCTGCACGTCTGCTGGGTCGCGAGGTGCTGTCCGCGCGCAGCGGCGCTTCGCTGCGGCGCCTGCAGCAGGCCGCGGCCCCGCGGGAGAAGCTTTTCGACA
AGATCCTCGTGGCCAACCGTGGCGAGATCGCCGTGCGCGTCATGCGCACGTGCCAGAAGTTGGGCATCAAGACGGTGGCCGTGTACTCGGAGCCTGATGT
AGACTCGGTGGCCGTGCGCATGGCTGATGAGGCCGTGTGCGTGGGGCCCGCGGCCTCGGCCCAGAGCTACTTGAGCATCCCCAAGATCGTGGCGGCCGTC
CAGGCCACGGGCGCCCAGGCCGTGCACCCGGGCTACGGCTTCCTCTCGGAGAACAAGGACTTCTGCGAGGCGCTGGAAGCCATCGGCGTGGCTTTCATCG
GGCCTGGACACGCAGCCATCCAGGCCATGGGAGACAAGATCGAGTCCAAGCAGCTGGCCATGGACGCAGGCGTCAACACGATCCCGGGCTTCCTGGGCGA
GATCGACACGCCTGAGGAGGCGGTAAAAGTGGCCCAGGAGATTGGATATCCCGTCATGATCAAGGCCAGCGCTGGCGGAGGCGGCAAGGGCATGCGCGTG
GCTTACAACGACGACGAGGTGCGCATGGGCTACCGCCTATCCAAGGAAGAAGCAGCCAGCAGCTTCGGAGACGACCGCATGTTCCTCGAGAAGTTCATTG
AAGACCCGCGGCATATCGAGATCCAGCTCATTGCCGACTCGTTCGGTAATGTGGTCCCGCTGCCCGAGAGAGAGTGCTCGATCCAACGGCGCAACCAGAA
GGTGATCGAGGAGGCGCCCAGTGTGCTACTCGACCCGGAGACGAGAAGGGCCATGGGCAAGCAGGCGGCCATGCTGGCCAACAAGGTGGGCTATGTGAGC
GCCGGTACGGTCGAGTTCTTGTGTGATAAGCACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGCAGGTGGAACACCCCGTCACAGAACTATTTC
TCACGTGGACCTAGTGGAGCAGATGATCCGTGTCGCTGCAGGTCACGAGCTGCCCAAGGAGTTGGTGGATGGACCTGTAAAGATCCACGGCTGGGCGATG
GAGAGTCGCGTGTATGCCGAGGATCCACTGCGTGGTTTCCTGCCGTCTATCGGCCGGCTGCTTCAATATGACGAGCCCGTGCACCTCCCGGGTGTGCGCG
TGGACTCAGGTGTGAACGAAGGCAGCGATATCTCCATGTTCTACGACCCGATGATCTCAAAGCTCATTACGTACGGCAAGGACCGTTCGGAGTGTTTGGA
GCGCATGAAGATTGCGCTGGACAACTACGTTATTCGCGGCCCTGGCAACAACGTTGCGTTCCTGCAGGATGTCTACCGTCACCCTCGCTTCGTGAGCGGT
AAGATTACCACCAAGTTCATCGAAGAGGAGTACCCGGACGGCTTTGAAGGTGTGAAGCTGACAGCACCTGAGATTGAGGACCTACGGGTGGTTGGCGCCA
TCATGCACCTAAAGAAGGCTATTGCCAGCAGCCAAATCTCGGGCCGAATTCAGTCAACACCAACGGAAGGTTTTCCCTCCTTCGACTCGCTCAACAATGA
CGATTTGGAGTTTGTTTCTCATCAAGAGGGAGTTGTCCCGCGCCTGCGTGCTTTCACCCCTGGTCTATCATCGGCGGAGTTGATCGCGATTGCGGAGCGA
AACGACCTCAAGAGTCTCGGTGCTCAGCTGTCGGTTAGCATCGATGGACCATTTGGAGAAGCGAAGCCTGTCGTTGTTGTCGAAGTGGAGCTTGAAAACG
CGCGGCACCGCATGGAAACGGCGACGCTCGCTTTTGTCGACAACAAGTGGCACGTTGTGGGCGATGTGGATTGGTCGCTGAACAGTCCGCTCTTCAAGGC
GTCATACGCAAAGCAGAACGGACCCAAAACTGCGCTGGCGTCGCAAATGCTGCAGACGCTGCCCGAGGGATTCCGTCTCCAATTTCACGGAGCAGTCCAT
GATGTCGTCGTACGCAACGAATTGGAGGCTGCGTACGGCATCCACATGAAGCCGAAACCCGAGGTCGACACGTCCAACTTGCTGCTATGCCCGATGCCCG
GCATGCTCATCTCAGTGGCTGTCGAGGTCGGCCAGCACGTGGAGCTTGGGCAGGAGCTGGCCGTCGTGGAGGCTATGAAGATGCAGAACGTGCTGCGCTC
TGAGAAGAGGGGCGTCATCAAAAGCATTGCGCATGCTGCTGGTGATTCACTCAAGGTTGACGAGATCATCCTCGAATACGAATAAGCGCTCTATGCTGCG
CTACAACTGGAAGGTCAACCTAGGCTAAGACGTAGCGGTGCACATGGAGATATGGAAAACAAA