Description :
From Genome Similarity Track
Location :
Scaffold_20:397614- 404620
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007916Similar to Pnn: Pinin (Mus musculus)
Pytul_DAOMBR144PYU1_G007915Similar to C11orf10: UPF0197 transmembrane protein C11orf10 (Homo sapiens)
Pytul_DAOMBR144PYU1_G007914candidate carbohydrate-binding protein
Pytul_DAOMBR144PYU1_G007913Protein of unknown function
Pytul_DAOMBR144PYU1_G007912microtubule plus-end binding protein

Sequence
7006 bases(100 bases per row)
CAAAGGAGACGGATGATCTCGTTGCGGCGTCAAAGGAGGCGCATGAAGAAAAAATGCAGATCCGTACTCGAGAACATCAGGTGCGGTTACACGAGCTGGA
AGCAGAATTTCAGAGTAAACTGGAGAAATACCGCGAGCAGCTGGAAGAAGCAAAGCAGGAAGCCACTAAGAACCCTGAAAAGGCTGGTGCTGATGGTGAG
CAGGTTGTCGAGGAAGAGGAGAAAGGAGAATCCAAGTCTGAGAAGGGAGAAGGAACCGTGAGCAACGACGAAGCAATGGATGCTGATGCAGCAGGCAGCA
AAGGTATTGAAGTACAGAAGCAGGAGAGCAATGAGAATGCTGAAATGTCGGACGCAGACTCACCTGAAATCAAAACTGATCGTGATGATGCGGATAACAA
AAATGCAGAAGCGGGGACTCCCGTGAAAGAAGAACTTGCAACACCCCAATGTCCAAGTCAGGAGGACGAACACGATGCCAATGCAGGTGAGGAAAGTAAA
CCTAGCACCAAGCCAGAAGAGCAGCCTGCGTCAGCTGACGCTATTGCTGATGAAGAGGTCAGTGGCGAGACAGACACTGTGAAGGAAGAAGCAGGAGCCT
CACAATCACCAAGCGAGCAAGAGAATCAGACAGACGTGAAACCGGAGCCTGTCAAGTCTAAATCACTGGAAACGCCAGTGAAACAAAAGGTCGATCTTTC
CAAGTTGAAAGTCGCGGAGCTTCGCGAGCAGCTGAAGAAGCGCGGGCTTGACACCAAAGGCCTCAAGTCGAATCTTCTCGAGCGGCTAGAAGAGGCCATG
GATCAAGAAGCTGCCTAGGTGCAAGGCTTCGAGTATCAGTGTAGATGAATGTAGTTGGGGCAGGTGATGCCGACAAAAAGCCGCGTCGCGGACGAAATGA
CAACATGCCTTCTCACCGTTTTGCTATTTATCACATTCGAGCAGCTCCAGTCTCATCACTTTTCGCTTTGTAAGCAAAACAATCATGAACTAAAAGAATC
ACGACACATCCTATGAAACAAAATACGAAACCCTCCTAAAGTAATATTTATTAACGTTACTAACTCGCTGCAATTAACAAAAAATTGATAGCAATAGCAA
CGCAAGTTTCTAATGTATTGCAATTTGTAAAGGGTACAGTGAAAGACGGATTTGCAACGAACGAGCAGCTCTATTTGATCAAATAGAGCCACGTGGGTGG
GGGGCAAAAGCGAAAGCAGATAGATATTGCACGCCGCGCAGCACCAGCACCATGGTGCGTCTCCTTCCTTCGCCTGCTGCTGCACTCTATGCCTAAGCAG
CGGCGGCCTGTTATGCTGCCTGTGCCCTTTATGTCTTCCTTTTAGCGGCTGTCGATCATTGACGCGTGCTCCTTCGTGTCCCTTGTCTTCGTGCCTGTAG
GAAATCCCATACACAAGTCCAGTGCCTACTGAGTCGTACGGCAGCCTCGCGCTGCTGTTGCTGCTCTCGGGCCTGACGTTCCTGTCGATCTTCTTCACGA
ACGTCGTTGCGCCAAAGAAGAACTTTTTCCTCGAGCTCGTGCTCGCGATCGTCGCGGCGTTCCTGCTCGGCTTTGGCTCGCTCTTCCTCTTCCTGTGGGC
CGAGATCTACGTGTAAAGAAGAGAACGTCGTGGATGCGCGTTTTGGGGCGAGTACCGGCATCATGTCGGGACGGGATTTACGTCATGAAATAAACAAGAA
GAGAGAGAGAAAGAGGGATGAAAGAGCTCGCGAAAAAAGGCTCCCATCTACCACGTTCGGCCCGGAGGAGATGGAACTGAAAAGCGAAAAGCGTATCGTC
GCGCACCTAATCGGCCACCATTGTCGTTGACGCGTATGGGAGGAAAATGAAAACTATATCTTTATTTTTGGGGTATGCTTGACTGTGCTACTGCTGCCTT
GAGATCTTCCGTGTGCCTATTGCTTTCTACTTGCACTAATTACACTGTTGCGGCGCTTTTCCCGTTGAGATCCGTGCGATTGAGGAGAGCATGAACCATG
ACGCACCTCGACAGGTTGACTCCTTCCTCATCAATCGCCGATAACTAATTCCATGCCGAAAGCAGCGACGGGCACCTTCTCCCATTAGCAGTGCTATCGT
ACTCGACGGGCCGAAATAATCCCCACCGAAGTCTGCATTCTTTCTCGAGACGCCACGTACATAAAAACGATTCCTGGTTCACCTCACCGGTTGCAACTCC
TCTACTGTGGAGAAACACACGCTTTCTTGTTTTCTTTCTTCACGCAATCCGCTTATTAGTTGGTACCGGGCATTAAACTATAGTAGACCGTGGTCACGAA
CTTCTGCTTGTATCGATTTGTGATCCCAAGCACCATCATGCCGTCCTTGATCGCTGTGCAGTAGAGATGATTCAGCGCTACATGCTGCGGCACAGGGAGC
AGTCGCGAATCAACAGTCGGTGGGGTCTACAAGAACAAGCAGCATGATACTAACTTGGTTAGCAATGCGTTCACGAAAGCGCGGGTAGTGAATCCCACAA
CACTCACCTTATTTAAAATAATGTGCCGTAAATGTGGAGGAAGCGGCGGCGGTTCTTTCGTGTATTCGTCGATATCGGGGATGAAGCGGCCGTACCCACT
CTCGCCATTTTCGTCCTTATCGTCATGCGCTGGACTGCCTTCAAAATCAGAGAGCGGGGTGAACTCCGACACGTCGACAAAGTTGTTGACGTTGCCTTCG
ACATCCGCGACCGTGAGTTGATCGGGAGCAAATCGCCACTCGTCGTCGACCACGAACTTGTACGCGTGCTTCCCCCGTGTCAGATTCGCAATGTACGTGA
AATCGTTACCGGATCGATGCATCGGGCACTGCTTCGACCAGCCATTGAACGTGCCCGTAATGTACACATTCCGGCCGCCGTGTTCCCATCGGAATACCAT
GGGCACGACTTCGTTGTTCTTCGAGCTGAGTCCATTATCGCTCTCCAGTGAGCCTCCTTTCTCGTCCAACTGCGACGTCGGCAAGCTATTCGACATGTAC
GACAGATCCGATGACGACGACGGGTGGTCGATATCCATGGCCTCGTTCGCGCCGCCATTATTGTCATTGCCATTAGAGCCTCTGCTCGACCCAAACATCA
GCTCGCGCTTCGGATCGCTACTGGTTTCCTGCGATTGATACATGCGCTGCTGGTGCGCCTGGTAGTCATTACCGCCGCCACCCCCTTTCTGGCTGGTATA
ATACGGATCATGGCCGCCCGAGTTGTACATATTCGCGTCGCGATTGTCGTGATACTGCTGCTGTGCTCCTCCTCGCGGCGACTGCTGGTGTTGTGACGAC
GGCTGTTGTCCGTAATGCGGGTAGTGATGCAATGGGTACTGGGACCCGCCGCCGCCGCTCGCATTCGTGCCGAGCTCGCTCGGGTTCGCATCGTGCTCCT
TACTGGACGTGCTGCCCATCCTGTAGTCTCACTGACTTCACTATCTCGTACGGCAATCGATGATGAAGAAAATAAAAAGTAAGCGAATACAGTGCAGCGT
TGTGTTCAAAGCCACGCACGCACGTCAACAAAGACGAGCGAGAAGCTGCGGAAATGCGCAGGGGAGACGGAGGCCAGAGGGGAGGTAGAGGAGAGGGGTC
TCGCCGCTCGATACAGGGACGATGGAAGGATGAACGCGCTCTTGGGTCGATGGCGTCGATACGGTAGAGACTGCCACTCACACAGACGCGCGCGCGTGTT
TCTTTCTCGTCTTCTCGGGTTTCTGGGGCGCTGCCTCTTACTGTGGGGAAGTGACCGAAGACCCACAGTTAAAAAGTGTGTGAGAGAGAGAAAAAAAAAA
CGGCCCTTGGGATCGCGTGCATTGCTTCGTTTCGCGCGACCTTCGTGCGACATCACGACAGATGGGGCGGAAAGCCTGCAATGGGAGGACTTCGCACGTC
AGGTGCGGCGCGCTGTGATGAACAGCTGGTGCAGCACCCTGAGATAGAGCATAAAATCTTAATATTGTATAGTATTGATTCTTTATATTTGTATAGAATT
ATAAAATGATTTTCAGAAGCTTGAAGTCAGTTTGTTTCAAAGAAGTTAGGCAACTGAGTATGCATTATCGCAGGTAAATCATTCTGGTTCTTTTCTTTTC
CTAAAATTCTCTTACGGTAAGTATCAAGTGCAGTGATACCACATGTGAGAGGGGGGCCTCTACCCTTTCGTTTGCACCTCCTGCATCACTTCATGTATTC
GGTTTAAACACACTTATCTTCAAATCCTTATGCTATTTACGAAACTCAACAAATAGTGAGCACTTTCAAAATCGATATAGGTGCGCTACGACCTAATACA
AAGGGAAAACTGATTCAGCCTCCCACTCTCTGCAAAGCTCTTGCCTGCCTGCATCAAAGCTTATTCGCTCTCCATCTCCATGAGGCACATGACGTAGAGA
AATGGCTCAAGTGCATTCTGAATTTGGCGCTGTCTACAGTTTCTATATGTGTATCTACAAGATCAACTCGCTCTCTCTCCCTCGCTGTGTGTGTCTGTCT
CTATCTTGCTGCTCTAAATTATAAATCGGGGTCGATATCCGCTCCCGCCGCTGCTTGGAGGCTCGACGAAAACGTCGAAGATGGGGCTGGTGCTGGAGGC
TGAAACCGAAATGCCGGTGCAACACCAGACTGAAAGGAGAACGTCGCTGGCTGCAGGAAATGAGGCGCAGGCGGAGACGCCGTCACTGTCGCCATTGGCG
TAGCTGCTGGTGCAAATGGCTGCTGCTGACGTTGGATCTGACTGTTGCTCTGTAGCTCCTCGCCGTCGTCGACTTGGAGAACAGAAAACACGTTGCTGCC
CTGGTACGCTGGCTGGACAGGCTTGACTTTCCGCGTCTCGGGGTTCGCACGTGGCACCTGCACGTCTTTTGGCGCCTGTGGAATGTGTGGAAAATGGGAG
AGGCCACGCATGCTCTTGCGTTAGAAGACAAGCCCACAATACGCTCGCCATTGGATTGTCGCAACGAATAACAGGTCGTACCGTCATCGTGGTGAGAAAG
CCTTGGAAACCCTCCGCTTCTTTTACCGGTGGCGGAGCGCCACTATACATGCACACATGAATGCAACAAACCAGATGAATACGAATGCAGGGTATATATC
CAATATGCAGGCTCTACGTACAACGCAAAGGTTGGTGCCGCCATGACAAACGTCGGGGCCGCAATGTTGATATTCTTCGCTGCTGCCACCTGGTACTGCA
GAGCGTTGTTGCGCTTCTTCACGCCCGCCATGCGCTCATTGAAATTGCGGATCTCATCCGACACCTGGATCGGTTTCTTTGTACCAGCATGCTTCTTGTT
GCTTCCAGACTTCTTTTTCGTTTCAATCACCGCCGTTCTGCACACGCGCGGACACAAGCGTGAATGCGGCACACACCACAGTTGAGATCTTACTGACCCG
CTCTTATAAGACGCACGAATAGTAGTTTGCAGCATGCACACACCTTGTGTCCTGCTTCTTGAGCGATTTAAACTGCGTGTTCTTCTTCAGCTTACCGCCG
CCGAGGCCATTGCCGGCATGCGGACTCTTCTTTCCTTTCACTTTGGCGCCTCCTTCACGCACGAAAAAGGTCCACAGCAGCCGCCACATTCCATAGCACA
CGCCAGCCAATGCATTAGCCTGTATGCATTAGCCATGTATACGCATCCACATACACGCACCGCTCGCCTTCTTCGCCATTTTCGACCAGAGCTCTTCGTT
TGCGTCCCAATCAATTCCGTCAACCCATTGTCTCGGCTCGTTTTTTTCTAAAACCGGCTCGGTCTGCTAAACCGCGGCTCGAAGTCGAACCGTCTAACCT
CGAACTGCTAGATCCACATCTCGTGCCACCATCAGCTTCACTTTGACAAGTCTTTTTATCCGGTCAAATGCCCTTTCCCTATATGAACAATACCCTCGTT
TATCCGAACGTATAGTAAGGCGTATAGTCGGTGGCAGTAGCCCATTGCGATGTTTCCCCTCTCCTGCCTCAATATGGGGAAACGACAGCAGTCAGTTATT
AGACAAACGCCACCCAAAAAGCAGGAGAAGCTCCAGCCTGCTGCTCTGTGTGTCTCTGTGGCCCAACAGCGCTTTCCCCGCCTCATCGCTCTTGCCATAC
ACAGACGCGCGTGATAACCAGATCCCCGTGGTGTCCTCTGCGTGTTTCCCAGCTCTCCAAACAGCGTCGCTAGCGAGAGGTAAACTTCAAAACAACCCAA
CGACAACTTTGAGAGCAAACATGGCGGCCGCGGACCAGAACATCGCGATGATGGACGGCACGTACTTTGTCGGGCGCAAGGAGATCCTCGACTGGGTCAA
CGGCATCTGCTTCACGAGTCTGAGCAAGGTGGAGCAGACGTGCACGGGCGCCGTGGCGTGCATGATCCTCGACTCGATGTACCCGGGCAAGGTGCCGATG
TCCAAGGTCGACTGGAGCGCGAACAAGGACTATGAGTACATCAACAACTACAAGGTGCTGCAGAAGTGTTTCACGAATCTCAAGATCGACAAACACATTG
AGGTCGACCGCCTCGTGCGCGGCAAATACCAGGACAATTTGGAGTTCATGCAATGGTTCAAGAAGTTTTACGAGCTCAATGCGTCGGGCCAGCCGTACGA
TGCGATCGCGCAGCGCGAGAAGGGCAAGGGCGGCGCATTGTACACGAGCAAGTTTGGCGGTAGCGGAGGCAGCGGTTCGGCGCCATCACCGACCCCTGCT
GGTGCGGCGGCTGCAGCTGCTGCGAGACGAAAGCCGACTGCGGCTCCAGGCGCTGCTGCTTCCAGAACAAAGCCACCAGGTGCCCCAAGTTCACTGGGAT
CGCGCGTCGGTGCCACAGGAGCAAAGACTGCAACGGGTGCGACGCGCCGCCCAGTAGGCAGCGCAGGCGCCAGTGCCGCCCCCGCTGCTGCAGCTGCTGC
CGTGAACCCGCAATTGGAGCGCGAATTGGAGGAACTGACGACTGCGAACGAGTCTTTGACGAATGAGAATGGCGAATTGCGTCTTGCGGTACGTTGTTGC
GTCGCG